DoriC: an updated database of bacterial and archaeal replication origins

Bacteria Archaea
Quick Search :
for

Search field:
 
Organism
Usually latin names are required (e.g. "Escherichia coli ", or "Bacillus subtilis"). The synbol * denotes all organisms.
 
Lineage
Actinobacteria: Actinobacteridae
Aquificae: Aquificales
Bacteroidetes: Bacteroidetes; Sphingobacteria
Chlamydiae: Chlamydiales
Chlorobi: Chlorobia
Chloroflexi: Dehalococcoidetes
Cyanobacteria: Chroococcales; Prochlorales; Gloeobacteria
Deinococcus-Thermus: Deinococci
Firmicutes: Bacillales; Clostridia; Lactobacillales; Mollicutes
Fusobacteria: Fusobacterales
Planctomycetes: Planctomycetacia
Proteobacteria: Alphaproteobacteria; Betaproteobacteria; Deltaproteobacteria; Gammaproteobacteria;Epsilonproteobacteria
Spirochaetes: Spirochaetales
Thermotogae: Thermotogales
...
Topology
There are two types for topology of chromosome, i.e. , Circular and Linear.
   
DoriC AC
The accession number of DoriC is assigned to a sequence and should remain linked to it.
In all current sequence libraries the accession number consists of "ORI" followed by 8 digits, e.g "ORI10010001".
 
Note
Dif sequences in DoriC can be searched by "Dif-like sequence" in this field. Here, the dif-like sequence means a 28-bp sequence sharing a high degree of homology (at least 23 out of the 28 bases of dif motif are identical) with the dif site of Escherichia coli (ggtgcgcataatgtatattatgttaaat) or Bacillus subtilis (acttcctagaatatatattatgtaaact).You can use the phrase "DnaA box motif" to find the 'species-specific' DnaA box instead of E. coli perfect DnaA box (TTATCCACA). And you can also browse the oriC verified in vitor by searching "confirmed by experiment".