DoriC database

DoriC accession number ORI10010050
Organism Listeria innocua Clip11262
RefSeq NC_003212.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Listeriaceae, Listeria.
Chromosome size 3011208 nt
Chromosome GC content 0.3744
OriC length 506 nt
OriC AT content 0.6838
The number of DnaA box 11
The location of oriC region 3011021..318 nt
The location of dnaA gene 319..1674 nt
The extremes of GC disparity 3011100 nt (minimum), 1449336 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (1 chain) was found between 1449102 and 1449129 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

ttttcacaacctcatcttttgtcttttttttggtattctgctaaatagtttaacacattgtcgcaatgaaatcctttcccagaaagTGTGGATAAgtagttaataacggctttttatTGTGGATAAccttttatttaagtttaaacTTATACACAattagtggttatttacacacattgactTGTGGATAAttaattctaacaatttcgttacagatttctttacacacaagTTATACACAagttaactggcTGTGGACAAccgtttttcacatctggacagtttTGTGGATAGattttgtaagtccttgctatcagagtgattttctgatattataattcctgtcgaatagaaatatagctggggaaaaataaagTTATCCACAatacattttcacttTGTGGATAAttttttaacagtgTTTGGATAAccttatccatggctttttctatcTGTGGATAActttagagcatccatttacattacacaaaaaaggggggttacta

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

14 135 P 14 135 0 2.68e-04 taagtttaaactta
14 371 P 14 453 0 2.68e-04 taaagttatccaca
16 114 P 16 372 -1 8.05e-04 tattgtggataac[ct]tt
12 181 F 12 398 0 4.29e-03 ttgtggataatt
14 221 F 14 232 -1 1.13e-02 tta[ct]acacaagtta
14 372 P 14 398 -1 1.13e-02 aaa[ga]ttatccacaa
11 119 F 11 423 0 1.72e-02 tggataacctt
11 167 R 11 167 0 1.72e-02 ttacacacatt
13 117 F 13 453 -1 4.18e-02 tgtggataac[ct]tt
13 143 F 13 229 -1 4.18e-02 aa[cg]ttatacacaa
13 163 F 13 217 -1 4.18e-02 tt[ac]tttacacaca
13 211 R 13 215 -1 4.18e-02 aca[gc]atttcttta
13 229 F 13 373 -1 4.18e-02 aagttat[ac]cacaa
13 370 P 13 423 -1 4.18e-02 ataa[ag]gttatcca
13 399 F 13 453 -1 4.18e-02 tgtggataa[tc]ttt
13 403 R 13 406 -1 4.18e-02 ga[tc]aattttttaa
10 116 F 10 181 0 6.87e-02 ttgtggataa
10 116 F 10 398 0 6.87e-02 ttgtggataa
10 181 P 10 376 0 6.87e-02 ttgtggataa
10 225 F 10 236 0 6.87e-02 acacaagtta
10 283 F 10 397 0 6.87e-02 tttgtggata
10 376 P 10 398 0 6.87e-02 ttatccacaa
12 86 F 12 182 -1 1.55e-01 tgtggataa[gt]ta
12 179 P 12 232 -1 1.55e-01 acttgtg[gt]ataa
12 229 P 12 453 -1 1.55e-01 aagttat[ac]caca
12 281 P 12 377 -1 1.55e-01 gt[ta]ttgtggata
12 381 R 12 476 -1 1.55e-01 caca[at]tacattt
12 423 F 12 455 -1 1.55e-01 tggataac[ct]tta
9 49 R 9 149 0 2.75e-01 ttaacacat
9 86 F 9 453 0 2.75e-01 tgtggataa
9 86 F 9 117 0 2.75e-01 tgtggataa
9 86 F 9 399 0 2.75e-01 tgtggataa
9 86 P 9 376 0 2.75e-01 tgtggataa
9 109 C 9 365 0 2.75e-01 ctttttatt
9 116 F 9 284 0 2.75e-01 ttgtggata
9 169 R 9 221 0 2.75e-01 acacacatt
9 181 F 9 284 0 2.75e-01 ttgtggata
9 182 F 9 453 0 2.75e-01 tgtggataa
9 362 R 9 489 0 2.75e-01 ggggaaaaa
9 391 R 9 391 0 2.75e-01 tttcacttt
11 86 P 11 144 -1 5.67e-01 tgtg[gt]ataagt
11 115 P 11 146 -1 5.67e-01 attgtg[gt]ataa
11 116 P 11 231 -1 5.67e-01 ttgtg[gt]ataac
11 117 F 11 252 -1 5.67e-01 tgtgga[tc]aacc
11 146 F 11 376 -1 5.67e-01 ttat[ac]cacaat
11 169 R 11 230 -1 5.67e-01 acaca[ct]attga
11 203 F 11 215 -1 5.67e-01 atttc[gt]ttaca
11 251 F 11 452 -1 5.67e-01 ctgtgga[ct]aac
11 488 F 11 489 -1 5.67e-01 aaaaa[ag]ggggg
8 0 F 8 265 0 1.10e+00 ttttcaca

Refseq NC_003212.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China