DoriC

DoriC accession number	ORI10010048
Organism	Listeria monocytogenes EGD-e
RefSeq	NC_003210.1
Topology	Circular
Lineage	Bacteria, Firmicutes, Bacillales, Listeriaceae, Listeria.
Chromosome size	2944528 nt
Chromosome GC content	0.3798
OriC length	504 nt
OriC AT content	0.6786
The number of DnaA box	12
The location of oriC region	2944342..317 nt
The location of dnaA gene	318..1673 nt
The extremes of GC disparity	2944494 nt (minimum), 1443681 nt (maximum)
Note	Dif-like sequence acttcctataatatatattatgtaaact (1 chain) was found between 1442174 and 1442201 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence	ttttcacaacctcatttatttgtctttttttcgtattcggtaaatagtttaacacattggcgcaatgaaatcctttcctagaaagTGTGGATAActcctgaataacgcctttttatTGTGGATAAccttttcaattagtttaaacTTATACACAattagtggttaattacacacaatggctTGTGGATAAttaaatctaacaatttcgttacagatttctttacacacaagTTATACACAagttaactggcTGTGGACAAccgtttttcacatctggacagtttTGTGGATAGatttggtaagtccttgctatcagagtgattttctgatattataattcctgtcgaatagaaatatagctggggaaaactaaagTTATCCACAatacatttttacttTGTGGATAAttttttaacagtgTTTGGATAAccTTATCCATAgctttttctatcTGTGGATAActttatagcatccatttacattacataaaaagggggggtacta
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 14 370 P 14 452 0 2.66e-04 taaagttatccaca 16 113 P 16 371 -1 7.98e-04 tattgtggataac[ct]tt 12 180 F 12 397 0 4.26e-03 ttgtggataatt 14 118 F 14 422 -1 1.12e-02 tggataacctt[ta]tc 14 220 F 14 231 -1 1.12e-02 tta[ct]acacaagtta 14 371 P 14 397 -1 1.12e-02 aaa[ga]ttatccacaa 11 69 R 11 69 0 1.70e-02 atcctttccta 11 85 F 11 452 0 1.70e-02 tgtggataact 11 85 P 11 373 0 1.70e-02 tgtggataact 13 116 F 13 452 -1 4.15e-02 tgtggataac[ct]tt 13 133 P 13 136 -1 4.15e-02 at[ta]agtttaaact 13 142 F 13 228 -1 4.15e-02 aa[cg]ttatacacaa 13 210 R 13 214 -1 4.15e-02 aca[gc]atttcttta 13 228 F 13 372 -1 4.15e-02 aagttat[ac]cacaa 13 398 F 13 452 -1 4.15e-02 tgtggataa[tc]ttt 13 402 R 13 405 -1 4.15e-02 ga[tc]aattttttaa 13 422 F 13 454 -1 4.15e-02 tggataac[ct]ttat 10 85 F 10 116 0 6.81e-02 tgtggataac 10 115 F 10 180 0 6.81e-02 ttgtggataa 10 115 F 10 397 0 6.81e-02 ttgtggataa 10 166 F 10 220 0 6.81e-02 ttacacacaa 10 180 P 10 375 0 6.81e-02 ttgtggataa 10 224 F 10 235 0 6.81e-02 acacaagtta 10 282 F 10 396 0 6.81e-02 tttgtggata 10 375 P 10 397 0 6.81e-02 ttatccacaa 10 477 R 10 477 0 6.81e-02 tacattacat 12 228 P 12 452 -1 1.53e-01 aagttat[ac]caca 12 280 P 12 376 -1 1.53e-01 gt[ta]ttgtggata 12 370 P 12 422 -1 1.53e-01 taa[ag]gttatcca 9 23 R 9 23 0 2.73e-01 ctttttttc 9 48 R 9 148 0 2.73e-01 ttaacacat 9 85 F 9 181 0 2.73e-01 tgtggataa 9 85 F 9 398 0 2.73e-01 tgtggataa 9 107 P 9 485 0 2.73e-01 cctttttat 9 115 F 9 283 0 2.73e-01 ttgtggata 9 180 F 9 283 0 2.73e-01 ttgtggata 9 181 F 9 452 0 2.73e-01 tgtggataa 9 387 R 9 387 0 2.73e-01 catttttac 11 32 R 11 174 -1 5.62e-01 gt[ag]ttcggtaa 11 41 F 11 132 -1 5.62e-01 aa[at]tagtttaa 11 84 F 11 419 -1 5.62e-01 gt[gt]tggataac 11 85 P 11 229 -1 5.62e-01 tgtg[gt]ataact 11 114 P 11 145 -1 5.62e-01 attgtg[gt]ataa 11 115 P 11 230 -1 5.62e-01 ttgtg[gt]ataac 11 116 F 11 251 -1 5.62e-01 tgtgga[tc]aacc 11 145 F 11 375 -1 5.62e-01 ttat[ac]cacaat 11 145 F 11 166 -1 5.62e-01 tta[tc]acacaat 11 158 F 11 182 -1 5.62e-01 gtgg[ta]taatta 11 179 P 11 231 -1 5.62e-01 cttgtg[gt]ataa 11 202 F 11 214 -1 5.62e-01 atttc[gt]ttaca

Refseq	NC_003210.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2