DoriC database

DoriC accession number ORI10010048
Organism Listeria monocytogenes EGD-e
RefSeq NC_003210.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Listeriaceae, Listeria.
Chromosome size 2944528 nt
Chromosome GC content 0.3798
OriC length 504 nt
OriC AT content 0.6786
The number of DnaA box 12
The location of oriC region 2944342..317 nt
The location of dnaA gene 318..1673 nt
The extremes of GC disparity 2944494 nt (minimum), 1443681 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (1 chain) was found between 1442174 and 1442201 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

ttttcacaacctcatttatttgtctttttttcgtattcggtaaatagtttaacacattggcgcaatgaaatcctttcctagaaagTGTGGATAActcctgaataacgcctttttatTGTGGATAAccttttcaattagtttaaacTTATACACAattagtggttaattacacacaatggctTGTGGATAAttaaatctaacaatttcgttacagatttctttacacacaagTTATACACAagttaactggcTGTGGACAAccgtttttcacatctggacagtttTGTGGATAGatttggtaagtccttgctatcagagtgattttctgatattataattcctgtcgaatagaaatatagctggggaaaactaaagTTATCCACAatacatttttacttTGTGGATAAttttttaacagtgTTTGGATAAccTTATCCATAgctttttctatcTGTGGATAActttatagcatccatttacattacataaaaagggggggtacta

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

14 370 P 14 452 0 2.66e-04 taaagttatccaca
16 113 P 16 371 -1 7.98e-04 tattgtggataac[ct]tt
12 180 F 12 397 0 4.26e-03 ttgtggataatt
14 118 F 14 422 -1 1.12e-02 tggataacctt[ta]tc
14 220 F 14 231 -1 1.12e-02 tta[ct]acacaagtta
14 371 P 14 397 -1 1.12e-02 aaa[ga]ttatccacaa
11 69 R 11 69 0 1.70e-02 atcctttccta
11 85 F 11 452 0 1.70e-02 tgtggataact
11 85 P 11 373 0 1.70e-02 tgtggataact
13 116 F 13 452 -1 4.15e-02 tgtggataac[ct]tt
13 133 P 13 136 -1 4.15e-02 at[ta]agtttaaact
13 142 F 13 228 -1 4.15e-02 aa[cg]ttatacacaa
13 210 R 13 214 -1 4.15e-02 aca[gc]atttcttta
13 228 F 13 372 -1 4.15e-02 aagttat[ac]cacaa
13 398 F 13 452 -1 4.15e-02 tgtggataa[tc]ttt
13 402 R 13 405 -1 4.15e-02 ga[tc]aattttttaa
13 422 F 13 454 -1 4.15e-02 tggataac[ct]ttat
10 85 F 10 116 0 6.81e-02 tgtggataac
10 115 F 10 180 0 6.81e-02 ttgtggataa
10 115 F 10 397 0 6.81e-02 ttgtggataa
10 166 F 10 220 0 6.81e-02 ttacacacaa
10 180 P 10 375 0 6.81e-02 ttgtggataa
10 224 F 10 235 0 6.81e-02 acacaagtta
10 282 F 10 396 0 6.81e-02 tttgtggata
10 375 P 10 397 0 6.81e-02 ttatccacaa
10 477 R 10 477 0 6.81e-02 tacattacat
12 228 P 12 452 -1 1.53e-01 aagttat[ac]caca
12 280 P 12 376 -1 1.53e-01 gt[ta]ttgtggata
12 370 P 12 422 -1 1.53e-01 taa[ag]gttatcca
9 23 R 9 23 0 2.73e-01 ctttttttc
9 48 R 9 148 0 2.73e-01 ttaacacat
9 85 F 9 181 0 2.73e-01 tgtggataa
9 85 F 9 398 0 2.73e-01 tgtggataa
9 107 P 9 485 0 2.73e-01 cctttttat
9 115 F 9 283 0 2.73e-01 ttgtggata
9 180 F 9 283 0 2.73e-01 ttgtggata
9 181 F 9 452 0 2.73e-01 tgtggataa
9 387 R 9 387 0 2.73e-01 catttttac
11 32 R 11 174 -1 5.62e-01 gt[ag]ttcggtaa
11 41 F 11 132 -1 5.62e-01 aa[at]tagtttaa
11 84 F 11 419 -1 5.62e-01 gt[gt]tggataac
11 85 P 11 229 -1 5.62e-01 tgtg[gt]ataact
11 114 P 11 145 -1 5.62e-01 attgtg[gt]ataa
11 115 P 11 230 -1 5.62e-01 ttgtg[gt]ataac
11 116 F 11 251 -1 5.62e-01 tgtgga[tc]aacc
11 145 F 11 375 -1 5.62e-01 ttat[ac]cacaat
11 145 F 11 166 -1 5.62e-01 tta[tc]acacaat
11 158 F 11 182 -1 5.62e-01 gtgg[ta]taatta
11 179 P 11 231 -1 5.62e-01 cttgtg[gt]ataa
11 202 F 11 214 -1 5.62e-01 atttc[gt]ttaca

Refseq NC_003210.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China