DoriC database

DoriC accession number ORI10010039
Organism Staphylococcus epidermidis RP62A
RefSeq NC_002976.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size 2616530 nt
Chromosome GC content 0.3215
OriC length 738 nt
OriC AT content 0.7344
The number of DnaA box 9
The location of oriC region 2616332..539 nt
The location of dnaA gene 2614976..2616331 nt
The extremes of GC disparity 2614108 nt (minimum), 1048723 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 964782 and 964809 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

aaataactccatctttcttaaaattttagacTTATACACAgaaataacataGGTGGATAAaaataatcacagcatgttaataaTTATCCACAagttaatcacaatcAGTGGATAActtaaacataactatgatTTATGCACAccatttatgtatataaatttaataaataaatccttataaaatcataatttgaacgacTTATCCACAtaattatactttttaactccaagtgatgtcaaatggctgtgaatatgttgttaaattttgaataactgtgtgtatagcgcatgtgTTATCCACAatttttgcgagaaattaTGTGTATAAGTGGATAActtcaaataagcgtcacaattccttcttttttactttgggaaataatttatatggattgcatgaactatgtatatgacaatttattattaaaattggtgaagaaaaaaattgcttatattaaatcacaacaagtcattttcaatcgttatattcgtaaattcatcttgctttataaaaggtattttgttatattgtagtagttgcttgaattatgactagataataataagctatagaacaaatttcttaatagcagacacaataagagagcaattgctcagatgaagtatgttagtaattgaagctaacatatacttcgttaatttatctatttatatgaaccaatttctaggtaggaagttggaaatattggtaattgaattcagatggaggtgttttgc

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

16 197 P 16 314 -1 1.71e-03 acttat[ca]cacataatt
13 659 R 13 659 0 2.28e-03 atttatctattta
15 103 F 15 324 -1 6.42e-03 at[ca]agtggataactt
12 604 P 12 604 0 9.13e-03 gagcaattgctc
14 29 P 14 316 -1 2.40e-02 acttatacaca[gt]aa
14 45 R 14 48 -1 2.40e-02 aa[ca]ataggtggata
14 646 C 14 670 -1 2.40e-02 atatactt[cg]gttaa
11 521 R 11 521 0 3.65e-02 tgttatattgt
13 83 F 13 293 -1 8.90e-02 ttatccacaa[gt]tt
13 155 R 13 376 -1 8.90e-02 ta[at]atttaataaa
13 443 R 13 482 -1 8.90e-02 aa[ta]tgcttatatt
10 18 P 10 18 0 1.46e-01 taaaatttta
10 246 R 10 321 0 1.46e-01 gtgaatatgt
10 358 C 10 434 0 1.46e-01 cttctttttt
12 28 F 12 196 -1 3.29e-01 gacttat[ac]caca
12 48 F 12 324 -1 3.29e-01 ata[ga]gtggataa
12 73 F 12 625 -1 3.29e-01 atgtta[ag]taatt
12 146 F 12 316 -1 3.29e-01 ttatgt[ag]tataa
12 168 R 12 484 -1 3.29e-01 taaat[cg]cttata
12 170 P 12 382 -1 3.29e-01 aatcc[ta]tataaa
12 180 C 12 416 -1 3.29e-01 aaat[ca]ataattt
12 207 C 12 666 -1 3.29e-01 ataa[ta]tatactt
12 401 F 12 665 -1 3.29e-01 ctat[gt]tatatga
12 572 F 12 675 -1 3.29e-01 gaac[ac]aatttct
12 628 F 12 706 -1 3.29e-01 tt[ag]gtaattgaa
9 29 C 9 247 0 5.84e-01 acttataca
9 56 R 9 56 0 5.84e-01 ataaaaata
9 76 R 9 76 0 5.84e-01 ttaataatt
9 83 F 9 199 0 5.84e-01 ttatccaca
9 107 P 9 292 0 5.84e-01 gtggataac
9 147 F 9 402 0 5.84e-01 tatgtatat
9 152 P 9 380 0 5.84e-01 atataaatt
9 162 R 9 162 0 5.84e-01 aataaataa
9 164 R 9 164 0 5.84e-01 taaataaat
9 199 F 9 293 0 5.84e-01 ttatccaca
9 204 P 9 314 0 5.84e-01 cacataatt
9 292 P 9 328 0 5.84e-01 gttatccac
9 317 R 9 317 0 5.84e-01 tatgtgtat
9 381 F 9 667 0 5.84e-01 atttatatg
9 404 C 9 644 0 5.84e-01 tgtatatga
9 417 P 9 557 0 5.84e-01 ttattatta
9 556 R 9 556 0 5.84e-01 ataataata
11 14 F 11 420 -1 1.21e+00 tt[ca]ttaaaatt
11 48 R 11 324 -1 1.21e+00 ataggtg[ga]ata
11 49 P 11 199 -1 1.21e+00 ta[gt]gtggataa
11 55 F 11 555 -1 1.21e+00 gataa[at]aataa
11 62 P 11 243 -1 1.21e+00 ata[at]tcacagc
11 73 P 11 419 -1 1.21e+00 at[gt]ttaataat
11 124 P 11 180 -1 1.21e+00 aa[ct]tatgattt
11 156 P 11 255 -1 1.21e+00 aaatttaa[tc]aa

Refseq NC_002976.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China