DoriC database

DoriC accession number ORI10010038
Organism Staphylococcus epidermidis RP62A
RefSeq NC_002976.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size 2616530 nt
Chromosome GC content 0.3215
OriC length 309 nt
OriC AT content 0.7152
The number of DnaA box 4
The location of oriC region 2614667..2614975 nt
The location of dnaA gene 2614976..2616331 nt
The extremes of GC disparity 2614108 nt (minimum), 1048723 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 964782 and 964809 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

taaatttaaactccttccagtcgtttatatataattatataggttttaaattcatagtaatagtagtaggcactgtggattGGTGGATAAgtctaaaaaacttacgaatagcacagTTATACACATGTGGATAAactgtgtatgttgtgtattattttttcacaTTATCCACAattgctattttttattcagagggacaactccccatctttttaagtgtttaggaattgatttacatagtaattattccctaaaagacagtttacaatctgctaattttcaatttattcaatatggatttatttccca

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

14 27 P 14 27 0 1.00e-04 tatataattatata
13 116 P 13 121 -1 1.56e-02 ttat[ac]cacatgtg
10 24 P 10 24 0 2.56e-02 ttatatataa
10 178 R 10 178 0 2.56e-02 tattttttat
9 1 R 9 1 0 1.02e-01 aaatttaaa
9 52 F 9 235 0 1.02e-01 catagtaat
9 125 P 9 164 0 1.02e-01 tgtggataa
9 151 R 9 180 0 1.02e-01 ttatttttt
11 38 C 11 165 -1 2.11e-01 ataggt[tg]ttaa
8 0 P 8 0 0 4.10e-01 taaattta
8 1 C 8 44 0 4.10e-01 aaatttaa
8 2 P 8 44 0 4.10e-01 aatttaaa
8 82 F 8 126 0 4.10e-01 gtggataa
8 82 P 8 164 0 4.10e-01 gtggataa
8 86 C 8 185 0 4.10e-01 ataagtct
8 114 C 8 288 0 4.10e-01 agttatac
8 131 P 8 257 0 4.10e-01 taaactgt
8 152 F 8 178 0 4.10e-01 tatttttt
8 183 F 8 283 0 4.10e-01 tttattca
10 0 P 10 277 -1 7.68e-01 taaatt[tg]aaa
10 23 R 10 26 -1 7.68e-01 tt[ta]atatata
10 34 R 10 294 -1 7.68e-01 ttat[at]taggt
10 46 P 10 292 -1 7.68e-01 taaat[tc]cata
10 53 F 10 59 -1 7.68e-01 atagta[ag]tag
10 175 F 10 270 -1 7.68e-01 tgcta[ta]tttt
7 0 R 7 44 0 1.64e+00 taaattt
7 0 C 7 3 0 1.64e+00 taaattt
7 24 F 7 34 0 1.64e+00 ttatata
7 25 R 7 25 0 1.64e+00 tatatat
7 25 C 7 26 0 1.64e+00 tatatat
7 30 P 7 240 0 1.64e+00 ataatta
7 31 F 7 240 0 1.64e+00 taattat
7 45 R 7 45 0 1.64e+00 ttaaatt
7 47 C 7 211 0 1.64e+00 aaattca
7 56 C 7 162 0 1.64e+00 gtaatag
7 73 F 7 125 0 1.64e+00 tgtggat
7 73 P 7 166 0 1.64e+00 tgtggat
7 93 C 7 153 0 1.64e+00 taaaaaa
7 93 C 7 179 0 1.64e+00 taaaaaa
7 93 P 7 180 0 1.64e+00 taaaaaa
7 106 P 7 175 0 1.64e+00 aatagca
7 111 P 7 133 0 1.64e+00 cacagtt
7 118 P 7 145 0 1.64e+00 atacaca
7 118 P 7 136 0 1.64e+00 atacaca
7 119 R 7 119 0 1.64e+00 tacacat
7 136 F 7 145 0 1.64e+00 tgtgtat
7 138 R 7 138 0 1.64e+00 tgtatgt
7 282 F 7 297 0 1.64e+00 atttatt
7 298 R 7 298 0 1.64e+00 tttattt
9 1 C 9 277 -1 2.77e+00 aaa[tg]ttaaa

Refseq NC_002976.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China