DoriC

DoriC accession number	ORI10010038
Organism	Staphylococcus epidermidis RP62A
RefSeq	NC_002976.1
Topology	Circular
Lineage	Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size	2616530 nt
Chromosome GC content	0.3215
OriC length	309 nt
OriC AT content	0.7152
The number of DnaA box	4
The location of oriC region	2614667..2614975 nt
The location of dnaA gene	2614976..2616331 nt
The extremes of GC disparity	2614108 nt (minimum), 1048723 nt (maximum)
Note	Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 964782 and 964809 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence	taaatttaaactccttccagtcgtttatatataattatataggttttaaattcatagtaatagtagtaggcactgtggattGGTGGATAAgtctaaaaaacttacgaatagcacagTTATACACATGTGGATAAactgtgtatgttgtgtattattttttcacaTTATCCACAattgctattttttattcagagggacaactccccatctttttaagtgtttaggaattgatttacatagtaattattccctaaaagacagtttacaatctgctaattttcaatttattcaatatggatttatttccca
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 14 27 P 14 27 0 1.00e-04 tatataattatata 13 116 P 13 121 -1 1.56e-02 ttat[ac]cacatgtg 10 24 P 10 24 0 2.56e-02 ttatatataa 10 178 R 10 178 0 2.56e-02 tattttttat 9 1 R 9 1 0 1.02e-01 aaatttaaa 9 52 F 9 235 0 1.02e-01 catagtaat 9 125 P 9 164 0 1.02e-01 tgtggataa 9 151 R 9 180 0 1.02e-01 ttatttttt 11 38 C 11 165 -1 2.11e-01 ataggt[tg]ttaa 8 0 P 8 0 0 4.10e-01 taaattta 8 1 C 8 44 0 4.10e-01 aaatttaa 8 2 P 8 44 0 4.10e-01 aatttaaa 8 82 F 8 126 0 4.10e-01 gtggataa 8 82 P 8 164 0 4.10e-01 gtggataa 8 86 C 8 185 0 4.10e-01 ataagtct 8 114 C 8 288 0 4.10e-01 agttatac 8 131 P 8 257 0 4.10e-01 taaactgt 8 152 F 8 178 0 4.10e-01 tatttttt 8 183 F 8 283 0 4.10e-01 tttattca 10 0 P 10 277 -1 7.68e-01 taaatt[tg]aaa 10 23 R 10 26 -1 7.68e-01 tt[ta]atatata 10 34 R 10 294 -1 7.68e-01 ttat[at]taggt 10 46 P 10 292 -1 7.68e-01 taaat[tc]cata 10 53 F 10 59 -1 7.68e-01 atagta[ag]tag 10 175 F 10 270 -1 7.68e-01 tgcta[ta]tttt 7 0 R 7 44 0 1.64e+00 taaattt 7 0 C 7 3 0 1.64e+00 taaattt 7 24 F 7 34 0 1.64e+00 ttatata 7 25 R 7 25 0 1.64e+00 tatatat 7 25 C 7 26 0 1.64e+00 tatatat 7 30 P 7 240 0 1.64e+00 ataatta 7 31 F 7 240 0 1.64e+00 taattat 7 45 R 7 45 0 1.64e+00 ttaaatt 7 47 C 7 211 0 1.64e+00 aaattca 7 56 C 7 162 0 1.64e+00 gtaatag 7 73 F 7 125 0 1.64e+00 tgtggat 7 73 P 7 166 0 1.64e+00 tgtggat 7 93 C 7 153 0 1.64e+00 taaaaaa 7 93 C 7 179 0 1.64e+00 taaaaaa 7 93 P 7 180 0 1.64e+00 taaaaaa 7 106 P 7 175 0 1.64e+00 aatagca 7 111 P 7 133 0 1.64e+00 cacagtt 7 118 P 7 145 0 1.64e+00 atacaca 7 118 P 7 136 0 1.64e+00 atacaca 7 119 R 7 119 0 1.64e+00 tacacat 7 136 F 7 145 0 1.64e+00 tgtgtat 7 138 R 7 138 0 1.64e+00 tgtatgt 7 282 F 7 297 0 1.64e+00 atttatt 7 298 R 7 298 0 1.64e+00 tttattt 9 1 C 9 277 -1 2.77e+00 aaa[tg]ttaaa

Refseq	NC_002976.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2