DoriC database

DoriC accession number ORI10010036
Organism Listeria monocytogenes str. 4b F2365
RefSeq NC_002973.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Listeriaceae, Listeria.
Chromosome size 2905187 nt
Chromosome GC content 0.3804
OriC length 193 nt
OriC AT content 0.6788
The number of DnaA box 5
The location of oriC region 1675..1867 nt
The location of dnaA gene 319..1674 nt
The extremes of GC disparity 2905079 nt (minimum), 1423383 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (1 chain) was found between 1421892 and 1421919 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
DnaA-trio The oriC contains the DnaA-trio element (3'-TTTAGGTGTCGCGGATAATGATAATGAT-5') retrieved by BLAST. Please refer to Richardson T.T. et al 2016 (Nature 534.7607: 412) fro more details.
OriC Sequence

tagacctgtgtacaaTGTGGATAActgaaacatacTTACCCACAagTTATCAACATGTGGAAAActttatgtcgcatggcttataacctacTTATCCACAaatccacagcgcctattactattactacgattttttattaattaattaaaggtttttgaggttttacaaaatataaaaaaatgggggatactc

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

12 136 R 12 136 0 6.24e-04 attaattaatta
12 137 P 12 137 0 6.24e-04 ttaattaattaa
14 132 P 14 136 -1 1.64e-03 ttt[ta]attaattaat
11 136 C 11 138 0 2.50e-03 attaattaatt
11 167 R 11 167 0 2.50e-03 aaaatataaaa
13 32 F 13 88 -1 6.09e-03 tactta[ct]ccacaa
10 139 R 10 139 0 9.99e-03 aattaattaa
12 14 F 12 54 -1 2.25e-02 atgtgga[ta]aact
12 14 P 12 44 -1 2.25e-02 atgt[gt]gataact
12 133 F 12 137 -1 2.25e-02 tt[ta]attaattaa
9 15 P 9 91 0 4.00e-02 tgtggataa
9 112 F 9 118 0 4.00e-02 ctattacta
9 173 R 9 173 0 4.00e-02 taaaaaaat
11 133 R 11 136 -1 8.24e-02 tt[ta]attaatta
8 7 R 8 51 0 1.60e-01 gtgtacaa
8 129 R 8 129 0 1.60e-01 atttttta
8 130 P 8 172 0 1.60e-01 ttttttat
8 141 P 8 141 0 1.60e-01 ttaattaa
10 28 F 10 84 -1 3.00e-01 aac[ac]tactta
10 133 C 10 139 -1 3.00e-01 tt[ta]attaatt
7 15 P 7 101 0 6.39e-01 tgtggat
7 19 P 7 44 0 6.39e-01 gataact
7 93 F 7 101 0 6.39e-01 atccaca
7 129 C 7 173 0 6.39e-01 atttttt
7 129 P 7 175 0 6.39e-01 atttttt
7 130 C 7 175 0 6.39e-01 tttttta
7 149 F 7 158 0 6.39e-01 aggtttt
7 151 R 7 151 0 6.39e-01 gtttttg
9 7 C 9 40 -1 1.08e+00 gtgt[at]caat
9 15 P 9 35 -1 1.08e+00 tgtgg[ag]taa
9 39 P 9 51 -1 1.08e+00 ccaca[at]gtt
9 46 F 9 91 -1 1.08e+00 ttatc[ac]aca
9 49 P 9 52 -1 1.08e+00 tc[ac]acatgt
9 55 P 9 91 -1 1.08e+00 tgtgga[at]aa
9 60 P 9 146 -1 1.08e+00 aaa[ac]cttta
9 129 C 9 164 -1 1.08e+00 at[tg]ttttat
9 130 C 9 167 -1 1.08e+00 tttt[ta]tatt
9 130 P 9 169 -1 1.08e+00 tttt[ta]tatt
9 133 P 9 136 -1 1.08e+00 tt[ta]attaat
9 147 C 9 162 -1 1.08e+00 aaa[gt]gtttt
9 170 F 9 172 -1 1.08e+00 ata[ta]aaaaa
6 8 C 6 52 0 2.56e+00 tgtaca
6 8 P 6 8 0 2.56e+00 tgtaca
6 18 C 6 111 0 2.56e+00 ggataa
6 27 R 6 164 0 2.56e+00 aaacat
6 35 C 6 179 0 2.56e+00 ttaccc
6 39 F 6 95 0 2.56e+00 ccacaa
6 46 R 6 117 0 2.56e+00 ttatca
6 55 P 6 102 0 2.56e+00 tgtgga
6 57 R 6 147 0 2.56e+00 tggaaa

Refseq NC_002973.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China