DoriC database

DoriC accession number ORI10010033
Organism Staphylococcus aureus subsp. aureus MRSA252
RefSeq NC_002952.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size 2902619 nt
Chromosome GC content 0.3281
OriC length 730 nt
OriC AT content 0.7178
The number of DnaA box 9
The location of oriC region 2902406..516 nt
The location of dnaA gene 517..1878 nt
The extremes of GC disparity 2902613 nt (minimum), 1472005 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 1447618 and 1447645 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

gcaaaacacctccatctttatacagttatctaatataccagattatgcagactctgatcacttcaatagataagattttgcgtttcttagattaaaattctcgtattagctcattgattatctagtcataattcaagcaactactacaatataacaaaatcctttttataacgcaagttcattttatactactgctcaatttttttacttttatcgattaaagatagaaatacacgatgcgagcaatcaaatttcataacatcaccatgagtttgatccaaagcatgagtgtttacaatgtttgaataccttatacagttcttatacatactttataaattatttcccaagctgttttgatacacacactaacagatactctatagaaggaaaagTTATCCACTTATGCACActtatactttttagaatTGTGGATAAttagaaattacacacaaagttatactatttttagcaacatattcacaggtatttgacatatagagaactgaaaaagtataattgTGTGGATAAgtcgtccaactcatgattttataaggatttatttattgatatttacataaaaatacTGTGCATAActaataagcaggataaagTTATCCACCgattgttattaactTGTGGATAAttattaacatggtgtgtttagaagTTATCCACGgttgttattttTGTGTATAActtaaaaatttaagaaagatggagtaaattt

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

16 403 R 16 475 -1 1.68e-03 ttatg[cg]acacttatac
16 408 P 16 508 -1 1.68e-03 caca[ca]ttatacttttt
13 218 R 13 218 0 2.23e-03 taaagatagaaat
13 428 F 13 636 0 2.23e-03 ttgtggataatta
12 391 F 12 610 0 8.93e-03 aaagttatccac
11 145 R 11 145 0 3.57e-02 acaatataaca
11 392 F 11 667 0 3.57e-02 aagttatccac
11 413 P 11 508 0 3.57e-02 ttatacttttt
11 576 R 11 576 0 3.57e-02 cataaaaatac
11 611 F 11 667 0 3.57e-02 aagttatccac
10 9 P 10 713 0 1.43e-01 ctccatcttt
10 17 F 10 310 0 1.43e-01 ttatacagtt
10 409 R 10 475 0 1.43e-01 acacttatac
12 139 R 12 255 -1 3.22e-01 ac[tc]actacaata
12 327 P 12 331 -1 3.22e-01 ata[ca]tttataaa
12 356 R 12 447 -1 3.22e-01 ttga[ta]acacaca
12 401 P 12 521 -1 3.22e-01 acttat[gc]cacac
12 574 P 12 684 -1 3.22e-01 taca[tc]aaaaata
12 697 R 12 700 -1 3.22e-01 aa[ct]ttaaaaatt
9 18 R 9 490 0 5.72e-01 tatacagtt
9 23 C 9 62 0 5.72e-01 agttatcta
9 60 C 9 666 0 5.72e-01 cttcaatag
9 64 R 9 64 0 5.72e-01 aatagataa
9 70 R 9 420 0 5.72e-01 taagatttt
9 76 R 9 76 0 5.72e-01 tttgcgttt
9 112 C 9 593 0 5.72e-01 attgattat
9 198 R 9 198 0 5.72e-01 attttttta
9 216 R 9 439 0 5.72e-01 attaaagat
9 311 R 9 490 0 5.72e-01 tatacagtt
9 403 P 9 587 0 5.72e-01 ttatgcaca
9 429 F 9 522 0 5.72e-01 tgtggataa
9 454 P 9 693 0 5.72e-01 aagttatac
9 506 R 9 506 0 5.72e-01 tgaaaaagt
9 522 F 9 637 0 5.72e-01 tgtggataa
9 557 R 9 557 0 5.72e-01 atttattta
9 559 R 9 559 0 5.72e-01 ttatttatt
9 644 R 9 644 0 5.72e-01 aattattaa
11 10 C 11 221 -1 1.18e+00 tc[ct]atctttat
11 19 F 11 608 -1 1.18e+00 ata[ca]agttatc
11 42 F 11 403 -1 1.18e+00 ttatgca[gc]act
11 62 P 11 559 -1 1.18e+00 tcaata[ga]ataa
11 82 P 11 705 -1 1.18e+00 tttctta[ga]att
11 141 C 11 543 -1 1.18e+00 tacta[ca]aatat
11 207 P 11 212 -1 1.18e+00 cttt[ta]atcgat
11 223 R 11 575 -1 1.18e+00 ata[ga]aaataca
11 264 R 11 299 -1 1.18e+00 ccat[ga]agtttg
11 265 P 11 535 -1 1.18e+00 catgagtt[tg]ga
11 279 P 11 539 -1 1.18e+00 aaa[gt]catgagt
11 335 C 11 706 -1 1.18e+00 taaatt[ac]tttc
11 361 R 11 443 -1 1.18e+00 acacaca[ct]taa

Refseq NC_002952.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China