DoriC database

DoriC accession number ORI10010032
Organism Staphylococcus aureus subsp. aureus MRSA252
RefSeq NC_002952.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size 2902619 nt
Chromosome GC content 0.3281
OriC length 277 nt
OriC AT content 0.7076
The number of DnaA box 4
The location of oriC region 1879..2155 nt
The location of dnaA gene 517..1878 nt
The extremes of GC disparity 2902613 nt (minimum), 1472005 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 1447618 and 1447645 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
DnaA-trio The oriC contains the DnaA-trio element (3'-GTTAGGTGTCGTGGATGATGATAATGAT-5') retrieved by BLAST. Please refer to Richardson T.T. et al 2016 (Nature 534.7607: 412) fro more details.
OriC Sequence

gtaggaaactttgggaaatgtaatctgttatataacagtactaataataacaatcattttttacatttctatatgctaatgtggcaagatgagcaaaactcatttTGTGGATAAtgtttaaaattcatacacgccatacacaagTTATCAACATGTGTATAActtcgccaaatctatgtttttaagacTTATCCACCaatccacagcacctactactattactaagaacttaaaacctatataattatatataaacgactggaaggagttttaatta

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

14 24 P 14 24 0 8.04e-05 ctgttatataacag
14 237 P 14 237 0 8.04e-05 tatataattatata
10 54 R 10 54 0 2.06e-02 cattttttac
10 244 P 10 244 0 2.06e-02 ttatatataa
12 38 R 12 45 -1 4.63e-02 tactaa[tc]aataa
12 147 R 12 152 -1 4.63e-02 tcaa[ct]atgtgta
9 14 P 9 60 0 8.23e-02 gaaatgtaa
9 59 R 9 59 0 8.23e-02 tttacattt
11 103 P 11 188 -1 1.70e-01 tt[tg]gtggataa
11 135 P 11 149 -1 1.70e-01 atacaca[at]gtt
8 15 C 8 59 0 3.29e-01 aaatgtaa
8 42 R 8 42 0 3.29e-01 aataataa
8 117 R 8 117 0 3.29e-01 ttaaaatt
8 119 R 8 227 0 3.29e-01 aaaattca
10 44 R 10 47 -1 6.17e-01 ta[ac]taacaat
10 48 R 10 218 -1 6.17e-01 aa[cg]aatcatt
10 89 C 10 97 -1 6.17e-01 tgag[ct]aaaac
10 94 P 10 262 -1 6.17e-01 aaaactc[ac]tt
10 101 R 10 263 -1 6.17e-01 attttg[ta]gga
10 106 C 10 206 -1 6.17e-01 gtggat[ag]atg
10 109 C 10 215 -1 6.17e-01 gataatg[ta]tt
10 144 R 10 210 -1 6.17e-01 ttatca[at]cat
10 242 R 10 245 -1 6.17e-01 aa[ta]tatatat
7 16 R 7 16 0 1.32e+00 aatgtaa
7 18 R 7 75 0 1.32e+00 tgtaatc
7 27 F 7 244 0 1.32e+00 ttatata
7 27 P 7 237 0 1.32e+00 ttatata
7 27 P 7 247 0 1.32e+00 ttatata
7 28 F 7 247 0 1.32e+00 tatataa
7 28 F 7 237 0 1.32e+00 tatataa
7 28 P 7 244 0 1.32e+00 tatataa
7 41 R 7 41 0 1.32e+00 taataat
7 53 F 7 99 0 1.32e+00 tcatttt
7 105 P 7 198 0 1.32e+00 tgtggat
7 119 C 7 179 0 1.32e+00 aaaattc
7 125 F 7 134 0 1.32e+00 catacac
7 141 P 7 158 0 1.32e+00 aagttat
7 179 P 7 228 0 1.32e+00 ttttaag
7 229 P 7 267 0 1.32e+00 ttaaaac
7 237 F 7 247 0 1.32e+00 tatataa
7 245 C 7 246 0 1.32e+00 tatatat
7 246 R 7 246 0 1.32e+00 atatata
9 38 F 9 41 -1 2.22e+00 ta[ca]taataa
9 38 F 9 219 -1 2.22e+00 tactaa[tg]aa
9 65 P 9 246 -1 2.22e+00 ttt[ca]tatat
9 66 R 9 156 -1 2.22e+00 ttc[ta]atatg
9 72 C 9 213 -1 2.22e+00 atg[ca]taatg
9 84 P 9 98 -1 2.22e+00 caa[ga]atgag
9 93 R 9 227 -1 2.22e+00 caaaa[ct]tca
9 94 F 9 119 -1 2.22e+00 aaaa[ct]tcat

Refseq NC_002952.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China