DoriC database

DoriC accession number ORI10010031
Organism Staphylococcus aureus subsp. aureus COL
RefSeq NC_002951.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size 2809422 nt
Chromosome GC content 0.3282
OriC length 730 nt
OriC AT content 0.7151
The number of DnaA box 9
The location of oriC region 2809236..543 nt
The location of dnaA gene 544..1905 nt
The extremes of GC disparity 297 nt (minimum), 1448643 nt (maximum)
Note Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 1423937 and 1423964 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

gcaaaacacctccatctttatacagttatctaatataccagattatgcagactctgatcactttaatagataagattttgcgtttcttagattaaaattctcgtattagctcattgattatctagtcataattcaagcaactactacaatataacaaaatcctatttataacgcaagttcattttatactactgctcaatttttttacttttatcgattaaagatagaaatacacgatgcgagcaatcaaatttcataacatcaccatgagtttggtccgaagcatgagtgtttacaatgttcgaacaccttatacagttcttatacatactttataaattatttcccaaactgttttgatacactcactaacagatactctatagaaggaaaagTTATCCACTTATGCACAtttatagttttcagaatTGTGGATAAttagaaattacacacaaagttatactatttttagcaacatattcacaggtatttgacatatagagaactgaaaaagtataattgTGTGGATAAgtcgtccaactcatgattttataaggatttatttattgatttttacataaaaatacTGTGCATAActaataagcaagataaagTTATCCACCgattgttattaactTGTGGATAAttattaacatggtgtgtttagaagTTATCCACGgctgttattttTGTGTATAActtaaaaatttaagaaagatggagtaaattt

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

13 218 R 13 218 0 2.23e-03 taaagatagaaat
13 428 F 13 636 0 2.23e-03 ttgtggataatta
12 391 F 12 610 0 8.93e-03 aaagttatccac
11 145 R 11 145 0 3.57e-02 acaatataaca
11 392 F 11 667 0 3.57e-02 aagttatccac
11 576 R 11 576 0 3.57e-02 cataaaaatac
11 611 F 11 667 0 3.57e-02 aagttatccac
13 60 P 13 210 -1 8.71e-02 ctttaat[ac]gataa
10 9 P 10 713 0 1.43e-01 ctccatcttt
10 17 F 10 310 0 1.43e-01 ttatacagtt
10 298 P 10 298 0 1.43e-01 tgttcgaaca
12 139 R 12 255 -1 3.22e-01 ac[tc]actacaata
12 327 P 12 331 -1 3.22e-01 ata[ca]tttataaa
12 409 R 12 566 -1 3.22e-01 acattt[at]tagtt
12 574 P 12 684 -1 3.22e-01 taca[tc]aaaaata
12 697 R 12 700 -1 3.22e-01 aa[ct]ttaaaaatt
9 18 R 9 490 0 5.72e-01 tatacagtt
9 64 R 9 64 0 5.72e-01 aatagataa
9 76 R 9 76 0 5.72e-01 tttgcgttt
9 112 C 9 593 0 5.72e-01 attgattat
9 198 R 9 198 0 5.72e-01 attttttta
9 216 R 9 439 0 5.72e-01 attaaagat
9 311 R 9 490 0 5.72e-01 tatacagtt
9 403 P 9 587 0 5.72e-01 ttatgcaca
9 429 F 9 522 0 5.72e-01 tgtggataa
9 454 P 9 693 0 5.72e-01 aagttatac
9 506 R 9 506 0 5.72e-01 tgaaaaagt
9 522 F 9 637 0 5.72e-01 tgtggataa
9 557 R 9 557 0 5.72e-01 atttattta
9 559 R 9 559 0 5.72e-01 ttatttatt
9 644 R 9 644 0 5.72e-01 aattattaa
11 10 C 11 221 -1 1.18e+00 tc[ct]atctttat
11 19 F 11 608 -1 1.18e+00 ata[ca]agttatc
11 63 C 11 116 -1 1.18e+00 taatagat[ac]ag
11 69 P 11 154 -1 1.18e+00 ata[ag]gattttg
11 82 P 11 705 -1 1.18e+00 tttctta[ga]att
11 141 C 11 543 -1 1.18e+00 tacta[ca]aatat
11 160 C 11 640 -1 1.18e+00 cctatt[ta]ataa
11 207 P 11 212 -1 1.18e+00 cttt[ta]atcgat
11 223 R 11 575 -1 1.18e+00 ata[ga]aaataca
11 335 C 11 706 -1 1.18e+00 taaatt[ac]tttc
11 392 P 11 691 -1 1.18e+00 aagttat[ca]cac
11 401 P 11 522 -1 1.18e+00 acttat[gc]caca
11 445 P 11 688 -1 1.18e+00 tta[ct]acacaaa
11 457 P 11 508 -1 1.18e+00 ttatact[at]ttt
11 557 F 11 561 -1 1.18e+00 atttatt[tg]att
11 564 C 11 592 -1 1.18e+00 tattgatt[ta]tt
11 564 C 11 695 -1 1.18e+00 tattga[ta]tttt
11 587 F 11 690 -1 1.18e+00 tgtg[ct]ataact
11 611 P 11 691 -1 1.18e+00 aagttat[ca]cac

Refseq NC_002951.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China