DoriC

DoriC accession number	ORI10010029
Organism	Pseudomonas putida KT2440
RefSeq	NC_002947.1
Topology	Circular
Lineage	Bacteria, Proteobacteria, Gammaproteobacteria, Pseudomonadales, Pseudomonadaceae, Pseudomonas.
Chromosome size	6181863 nt
Chromosome GC content	0.6152
OriC length	595 nt
OriC AT content	0.516
The number of DnaA box	8
The location of oriC region	8947..9541 nt
The location of dnaA gene	9542..11062 nt
The extremes of GC disparity	464 nt (minimum), 3730087 nt (maximum)
Note	Here the oriC region has been confirmed by experiment. Please refer to Smith D.W. et al. 1991 (Mol Microbiol. 5(11):2581-2587) for more details. Dif-like sequence ggtgctcataatgcatattatgttaaat (1 chain) was found between 3730778 and 3730805 nt, matches 26 sites compared with the 28-bp dif sequence ggtgcgcataatgtatattatgttaaat of E. coli.
OriC Sequence	ggcgtgttacctggtttgtcgacgacgggccgggatggccccctttttaagagaccggcgattctagagaaagcaagcccataggtcaatttccaaccagtctttccatatagagcatgtgatggacggtgcctgttgatcagtgcccaaggggtgcttgatcggacacacggatcggggacaacatgaaaaaaaagaagagacatataaaaagcttttttgaagaacttataactcttaAGTGGATAAccttcTGTGGATAAcctgcgctggcccatgaattacggggtgtacagagttttacaactttgttctgatcccgtgctgcgcttgttccaatcgtgagcgaaagcTGTGGATGAaaacacctgTTATCCACAgcggagTTATCAACAggctaaggggtggggttgtgcatagccctcatggtcgtTTATCCACAgggcTTATTCACAgaggcgaaaagccgttttggtcgataaatggctgttttgtcgtggttcctaacgtgtccacaTGTGGATAActgaacgctcgaccggtacaatggcggtttgtttttgcctcatccggctttcaaactcaggggatatcc
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 12 208 P 12 208 0 5.93e-03 aaaaagcttttt 12 485 R 12 485 0 5.93e-03 gctgttttgtcg 12 511 P 12 511 0 5.93e-03 tccacatgtgga 11 241 F 11 255 0 2.37e-02 gtggataacct 11 253 P 11 370 0 2.37e-02 ctgtggataac 10 130 P 10 388 0 9.50e-02 gcctgttgat 10 187 R 10 187 0 9.50e-02 gaaaaaaaag 10 253 P 10 433 0 9.50e-02 ctgtggataa 10 254 F 10 517 0 9.50e-02 tgtggataac 10 370 P 10 517 0 9.50e-02 gttatccaca 10 371 F 10 433 0 9.50e-02 ttatccacag 12 167 C 12 411 -1 2.14e-01 acacg[gt]atcggg 9 241 F 9 518 0 3.80e-01 gtggataac 9 241 P 9 370 0 3.80e-01 gtggataac 9 351 P 9 373 0 3.80e-01 gctgtggat 9 401 R 9 401 0 3.80e-01 ggggtgggg 9 433 P 9 517 0 3.80e-01 ttatccaca 11 10 R 11 485 -1 7.83e-01 ctg[gt]tttgtcg 11 10 F 11 486 -1 7.83e-01 ctg[gt]tttgtcg 11 80 R 11 237 -1 7.83e-01 ataggt[cg]aatt 11 252 P 11 446 -1 7.83e-01 tctgtg[ga]ataa 11 253 P 11 385 -1 7.83e-01 ctgt[gt]gataac 11 352 P 11 432 -1 7.83e-01 ctgtggat[ga]aa 11 370 F 11 385 -1 7.83e-01 gttatc[ca]acag 11 384 P 11 517 -1 7.83e-01 agttatc[ac]aca 11 386 F 11 433 -1 7.83e-01 ttatc[ac]acagg 11 481 F 11 545 -1 7.83e-01 aatggc[tg]gttt 8 26 R 8 26 0 1.52e+00 gggccggg 8 148 F 8 399 0 1.52e+00 aaggggtg 8 160 R 8 392 0 1.52e+00 atcggaca 8 241 P 8 433 0 1.52e+00 gtggataa 8 253 F 8 352 0 1.52e+00 ctgtggat 8 287 R 8 514 0 1.52e+00 ggtgtaca 8 287 C 8 512 0 1.52e+00 ggtgtaca 8 364 R 8 509 0 1.52e+00 acacctgt 8 459 R 8 459 0 1.52e+00 cgaaaagc 8 587 P 8 587 0 1.52e+00 ggatatcc 10 7 R 10 470 -1 2.85e+00 ta[cg]ctggttt 10 188 F 10 191 -1 2.85e+00 aaaaa[ag]aaga 10 250 C 10 360 -1 2.85e+00 ctt[ct]tgtgga 10 304 R 10 329 -1 2.85e+00 aac[tc]ttgttc 10 371 F 10 446 -1 2.85e+00 ttat[ct]cacag 10 433 F 10 446 -1 2.85e+00 ttat[ct]cacag 10 455 P 10 557 -1 2.85e+00 gaggc[ga]aaaa 10 466 R 10 555 -1 2.85e+00 ccgtttt[gt]gt 10 474 R 10 479 -1 2.85e+00 gtcg[ag]taaat 7 4 C 7 543 0 6.08e+00 tgttacc 7 12 F 7 551 0 6.08e+00 ggtttgt 7 14 R 7 485 0 6.08e+00 tttgtcg 7 14 F 7 490 0 6.08e+00 tttgtcg

Refseq	NC_002947.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2