DoriC database

DoriC accession number ORI10010029
Organism Pseudomonas putida KT2440
RefSeq NC_002947.1
Topology Circular
Lineage Bacteria, Proteobacteria, Gammaproteobacteria, Pseudomonadales, Pseudomonadaceae, Pseudomonas.
Chromosome size 6181863 nt
Chromosome GC content 0.6152
OriC length 595 nt
OriC AT content 0.516
The number of DnaA box 8
The location of oriC region 8947..9541 nt
The location of dnaA gene 9542..11062 nt
The extremes of GC disparity 464 nt (minimum), 3730087 nt (maximum)
Note Here the oriC region has been confirmed by experiment. Please refer to Smith D.W. et al. 1991 (Mol Microbiol. 5(11):2581-2587) for more details. Dif-like sequence ggtgctcataatgcatattatgttaaat (1 chain) was found between 3730778 and 3730805 nt, matches 26 sites compared with the 28-bp dif sequence ggtgcgcataatgtatattatgttaaat of E. coli.
OriC Sequence

ggcgtgttacctggtttgtcgacgacgggccgggatggccccctttttaagagaccggcgattctagagaaagcaagcccataggtcaatttccaaccagtctttccatatagagcatgtgatggacggtgcctgttgatcagtgcccaaggggtgcttgatcggacacacggatcggggacaacatgaaaaaaaagaagagacatataaaaagcttttttgaagaacttataactcttaAGTGGATAAccttcTGTGGATAAcctgcgctggcccatgaattacggggtgtacagagttttacaactttgttctgatcccgtgctgcgcttgttccaatcgtgagcgaaagcTGTGGATGAaaacacctgTTATCCACAgcggagTTATCAACAggctaaggggtggggttgtgcatagccctcatggtcgtTTATCCACAgggcTTATTCACAgaggcgaaaagccgttttggtcgataaatggctgttttgtcgtggttcctaacgtgtccacaTGTGGATAActgaacgctcgaccggtacaatggcggtttgtttttgcctcatccggctttcaaactcaggggatatcc

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

12 208 P 12 208 0 5.93e-03 aaaaagcttttt
12 485 R 12 485 0 5.93e-03 gctgttttgtcg
12 511 P 12 511 0 5.93e-03 tccacatgtgga
11 241 F 11 255 0 2.37e-02 gtggataacct
11 253 P 11 370 0 2.37e-02 ctgtggataac
10 130 P 10 388 0 9.50e-02 gcctgttgat
10 187 R 10 187 0 9.50e-02 gaaaaaaaag
10 253 P 10 433 0 9.50e-02 ctgtggataa
10 254 F 10 517 0 9.50e-02 tgtggataac
10 370 P 10 517 0 9.50e-02 gttatccaca
10 371 F 10 433 0 9.50e-02 ttatccacag
12 167 C 12 411 -1 2.14e-01 acacg[gt]atcggg
9 241 F 9 518 0 3.80e-01 gtggataac
9 241 P 9 370 0 3.80e-01 gtggataac
9 351 P 9 373 0 3.80e-01 gctgtggat
9 401 R 9 401 0 3.80e-01 ggggtgggg
9 433 P 9 517 0 3.80e-01 ttatccaca
11 10 R 11 485 -1 7.83e-01 ctg[gt]tttgtcg
11 10 F 11 486 -1 7.83e-01 ctg[gt]tttgtcg
11 80 R 11 237 -1 7.83e-01 ataggt[cg]aatt
11 252 P 11 446 -1 7.83e-01 tctgtg[ga]ataa
11 253 P 11 385 -1 7.83e-01 ctgt[gt]gataac
11 352 P 11 432 -1 7.83e-01 ctgtggat[ga]aa
11 370 F 11 385 -1 7.83e-01 gttatc[ca]acag
11 384 P 11 517 -1 7.83e-01 agttatc[ac]aca
11 386 F 11 433 -1 7.83e-01 ttatc[ac]acagg
11 481 F 11 545 -1 7.83e-01 aatggc[tg]gttt
8 26 R 8 26 0 1.52e+00 gggccggg
8 148 F 8 399 0 1.52e+00 aaggggtg
8 160 R 8 392 0 1.52e+00 atcggaca
8 241 P 8 433 0 1.52e+00 gtggataa
8 253 F 8 352 0 1.52e+00 ctgtggat
8 287 R 8 514 0 1.52e+00 ggtgtaca
8 287 C 8 512 0 1.52e+00 ggtgtaca
8 364 R 8 509 0 1.52e+00 acacctgt
8 459 R 8 459 0 1.52e+00 cgaaaagc
8 587 P 8 587 0 1.52e+00 ggatatcc
10 7 R 10 470 -1 2.85e+00 ta[cg]ctggttt
10 188 F 10 191 -1 2.85e+00 aaaaa[ag]aaga
10 250 C 10 360 -1 2.85e+00 ctt[ct]tgtgga
10 304 R 10 329 -1 2.85e+00 aac[tc]ttgttc
10 371 F 10 446 -1 2.85e+00 ttat[ct]cacag
10 433 F 10 446 -1 2.85e+00 ttat[ct]cacag
10 455 P 10 557 -1 2.85e+00 gaggc[ga]aaaa
10 466 R 10 555 -1 2.85e+00 ccgtttt[gt]gt
10 474 R 10 479 -1 2.85e+00 gtcg[ag]taaat
7 4 C 7 543 0 6.08e+00 tgttacc
7 12 F 7 551 0 6.08e+00 ggtttgt
7 14 R 7 485 0 6.08e+00 tttgtcg
7 14 F 7 490 0 6.08e+00 tttgtcg

Refseq NC_002947.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China