DoriC

DoriC accession number	ORI10010028
Organism	Geobacter sulfurreducens PCA
RefSeq	NC_002939.1
Topology	Circular
Lineage	Bacteria, Proteobacteria, Deltaproteobacteria, Desulfuromonadales, Geobacteraceae, Geobacter.
Chromosome size	3814139 nt
Chromosome GC content	0.6094
OriC length	836 nt
OriC AT content	0.4809
The number of DnaA box	3
The location of oriC region	3813333..29 nt
The location of dnaA gene	30..1367, 1166019..1166795 nt
The extremes of GC disparity	7871 nt (minimum), 1911380 nt (maximum)
Note	Dif-like sequence acgtcccataagatatattatgtaaagt (-1 chain) was found between 1891866 and 1891893 nt, matches 23 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence	tccaagcctgcgaggcgttcaacaaccgggccaagctcccggcagacgccgtgataatcaagccgctcggcgcccttctttgcaatgacattcagatcaatgctcggaagggcgtcacgatggtgccggtaatactcccgcacaagtcgcttgatgcggttacgtaccacagccgttcccaccttgcggctaacagtgattccaatccgtctccgtcctgtttcacctggcgtccaaagaacaatgaagctggacgtatgaagctttcgcgccgctgcggagagccgaagaaaatcggccctccgcagcagacgctcatccttggtaaaacggaacagggtcgaacgtcctacttgccggcgatggaaaccgaaagtctcttccgccccttggcacggcgacgcttgatgaccagacggccgtttttggttgccatgcgtacgagaaagccgtgggtgcgcttacgcgacgtattactcggttgataagtcctcttcatgggttctctccgtacagtgaaaatcgagggtgttctcggggattgcaaagaggatacttTTAACCACAgagacccttatatgtcaagagtttatttacttaccctgcaataaattgaccttgcaaattggaccaccgtctgctagtctgcatcttcccaagactgccgaaatggctgtaaaagccaccatttcacgttacaaccccccggtttttcgtagttatttagTTATCAACAgttgttgaaaaaccTGTGTATAActaataagtttcactatctcccggcgagtacgggttctgagcgactgagcttcgcgtttcccgagaaggtctggttt
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 15 273 P 15 294 -1 8.24e-03 gctgcggag[ag]gccga 11 23 R 11 23 0 4.69e-02 aaccgggccaa 10 76 P 10 540 0 1.87e-01 tctttgcaat 12 267 C 12 392 -1 4.22e-01 cg[ct]gccgctgcg 12 724 C 12 729 -1 4.22e-01 tagtt[ag]tcaaca 12 732 R 12 735 -1 4.22e-01 aa[ca]agttgttga 9 17 P 9 736 0 7.50e-01 ttcaacaac 9 38 R 9 412 0 7.50e-01 ccggcagac 9 147 F 9 401 0 7.50e-01 cgcttgatg 9 433 R 9 433 0 7.50e-01 catgcgtac 9 450 R 9 450 0 7.50e-01 cgtgggtgc 9 654 C 9 790 0 7.50e-01 cccaagact 11 176 C 11 336 -1 1.55e+00 tccca[cg]cttgc 11 188 R 11 514 -1 1.55e+00 gctaa[ca]agtga 11 219 C 11 621 -1 1.55e+00 gttt[ca]acctgg 11 307 C 11 634 -1 1.55e+00 gcagacg[ca]tca 11 589 F 11 719 -1 1.55e+00 ttattta[cg]tta 8 18 C 8 735 0 3.00e+00 tcaacaac 8 35 F 8 776 0 3.00e+00 ctcccggc 8 35 R 8 295 0 3.00e+00 ctcccggc 8 40 C 8 633 0 3.00e+00 ggcagacg 8 41 F 8 307 0 3.00e+00 gcagacgc 8 53 R 8 757 0 3.00e+00 ataatcaa 8 70 P 8 106 0 3.00e+00 cgcccttc 8 243 F 8 257 0 3.00e+00 atgaagct 8 289 F 8 517 0 3.00e+00 gaaaatcg 8 295 R 8 776 0 3.00e+00 cggccctc 8 306 P 8 634 0 3.00e+00 agcagacg 8 353 R 8 416 0 3.00e+00 ttgccggc 8 415 P 8 415 0 3.00e+00 acggccgt 8 445 R 8 662 0 3.00e+00 aaagccgt 8 480 P 8 727 0 3.00e+00 gttgataa 8 531 P 8 818 0 3.00e+00 ttctcggg 8 605 C 8 718 0 3.00e+00 caataaat 8 707 P 8 742 0 3.00e+00 ggtttttc 8 723 P 8 755 0 3.00e+00 ttagttat 10 1 F 10 655 -1 5.62e+00 ccaag[ca]ctgc 10 13 R 10 179 -1 5.62e+00 ggcgttc[ac]ac 10 20 P 10 704 -1 5.62e+00 aa[ca]aaccggg 10 25 P 10 388 -1 5.62e+00 ccg[gt]gccaag 10 41 R 10 304 -1 5.62e+00 gcagacg[ca]cg 10 61 C 10 277 -1 5.62e+00 gcc[gt]ctcggc 10 119 C 10 164 -1 5.62e+00 atggtg[ct]cgg 10 154 F 10 456 -1 5.62e+00 tgcg[gc]ttacg 10 186 R 10 289 -1 5.62e+00 cggctaa[ca]ag 10 290 P 10 417 -1 5.62e+00 aaaa[ta]cggcc 10 308 P 10 796 -1 5.62e+00 cag[at]cgctca 10 312 R 10 347 -1 5.62e+00 cg[ct]tcatcct 10 350 P 10 779 -1 5.62e+00 tact[tc]gccgg 10 554 C 10 619 -1 5.62e+00 ac[tg]tttaacc

Refseq	NC_002939.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2