DoriC database

DoriC accession number ORI10010028
Organism Geobacter sulfurreducens PCA
RefSeq NC_002939.1
Topology Circular
Lineage Bacteria, Proteobacteria, Deltaproteobacteria, Desulfuromonadales, Geobacteraceae, Geobacter.
Chromosome size 3814139 nt
Chromosome GC content 0.6094
OriC length 836 nt
OriC AT content 0.4809
The number of DnaA box 3
The location of oriC region 3813333..29 nt
The location of dnaA gene 30..1367, 1166019..1166795 nt
The extremes of GC disparity 7871 nt (minimum), 1911380 nt (maximum)
Note Dif-like sequence acgtcccataagatatattatgtaaagt (-1 chain) was found between 1891866 and 1891893 nt, matches 23 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence


The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

15 273 P 15 294 -1 8.24e-03 gctgcggag[ag]gccga
11 23 R 11 23 0 4.69e-02 aaccgggccaa
10 76 P 10 540 0 1.87e-01 tctttgcaat
12 267 C 12 392 -1 4.22e-01 cg[ct]gccgctgcg
12 724 C 12 729 -1 4.22e-01 tagtt[ag]tcaaca
12 732 R 12 735 -1 4.22e-01 aa[ca]agttgttga
9 17 P 9 736 0 7.50e-01 ttcaacaac
9 38 R 9 412 0 7.50e-01 ccggcagac
9 147 F 9 401 0 7.50e-01 cgcttgatg
9 433 R 9 433 0 7.50e-01 catgcgtac
9 450 R 9 450 0 7.50e-01 cgtgggtgc
9 654 C 9 790 0 7.50e-01 cccaagact
11 176 C 11 336 -1 1.55e+00 tccca[cg]cttgc
11 188 R 11 514 -1 1.55e+00 gctaa[ca]agtga
11 219 C 11 621 -1 1.55e+00 gttt[ca]acctgg
11 307 C 11 634 -1 1.55e+00 gcagacg[ca]tca
11 589 F 11 719 -1 1.55e+00 ttattta[cg]tta
8 18 C 8 735 0 3.00e+00 tcaacaac
8 35 F 8 776 0 3.00e+00 ctcccggc
8 35 R 8 295 0 3.00e+00 ctcccggc
8 40 C 8 633 0 3.00e+00 ggcagacg
8 41 F 8 307 0 3.00e+00 gcagacgc
8 53 R 8 757 0 3.00e+00 ataatcaa
8 70 P 8 106 0 3.00e+00 cgcccttc
8 243 F 8 257 0 3.00e+00 atgaagct
8 289 F 8 517 0 3.00e+00 gaaaatcg
8 295 R 8 776 0 3.00e+00 cggccctc
8 306 P 8 634 0 3.00e+00 agcagacg
8 353 R 8 416 0 3.00e+00 ttgccggc
8 415 P 8 415 0 3.00e+00 acggccgt
8 445 R 8 662 0 3.00e+00 aaagccgt
8 480 P 8 727 0 3.00e+00 gttgataa
8 531 P 8 818 0 3.00e+00 ttctcggg
8 605 C 8 718 0 3.00e+00 caataaat
8 707 P 8 742 0 3.00e+00 ggtttttc
8 723 P 8 755 0 3.00e+00 ttagttat
10 1 F 10 655 -1 5.62e+00 ccaag[ca]ctgc
10 13 R 10 179 -1 5.62e+00 ggcgttc[ac]ac
10 20 P 10 704 -1 5.62e+00 aa[ca]aaccggg
10 25 P 10 388 -1 5.62e+00 ccg[gt]gccaag
10 41 R 10 304 -1 5.62e+00 gcagacg[ca]cg
10 61 C 10 277 -1 5.62e+00 gcc[gt]ctcggc
10 119 C 10 164 -1 5.62e+00 atggtg[ct]cgg
10 154 F 10 456 -1 5.62e+00 tgcg[gc]ttacg
10 186 R 10 289 -1 5.62e+00 cggctaa[ca]ag
10 290 P 10 417 -1 5.62e+00 aaaa[ta]cggcc
10 308 P 10 796 -1 5.62e+00 cag[at]cgctca
10 312 R 10 347 -1 5.62e+00 cg[ct]tcatcct
10 350 P 10 779 -1 5.62e+00 tact[tc]gccgg
10 554 C 10 619 -1 5.62e+00 ac[tg]tttaacc

Refseq NC_002939.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
Figure 2

School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China