DoriC database

DoriC accession number ORI10010027
Organism Geobacter sulfurreducens PCA
RefSeq NC_002939.1
Topology Circular
Lineage Bacteria, Proteobacteria, Deltaproteobacteria, Desulfuromonadales, Geobacteraceae, Geobacter.
Chromosome size 3814139 nt
Chromosome GC content 0.6094
OriC length 226 nt
OriC AT content 0.5044
The number of DnaA box 4
The location of oriC region 1368..1593 nt
The location of dnaA gene 30..1367, 1166019..1166795 nt
The extremes of GC disparity 7871 nt (minimum), 1911380 nt (maximum)
Note Dif-like sequence acgtcccataagatatattatgtaaagt (-1 chain) was found between 1891866 and 1891893 nt, matches 23 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

gaggcaacaaccctgtggacagaggaacagTTATCTACAtgccgttgtccctgtccgaggacgtcCGTGGATAAccaacgccgtgcccacaggacggcatactgaaaataacgagctacaaaggggcgttgggcgaTTATCCCCATATCCACAgcccctactgtttctactgatgttttaagaaaacataaccataactatgatgacctgttgaaaaggaggagcg

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

9 45 R 9 45 0 5.48e-02 tgtccctgt
11 21 R 11 210 -1 1.13e-01 gaggaa[ca]agtt
8 58 P 8 58 0 2.19e-01 ggacgtcc
8 74 P 8 124 0 2.19e-01 ccaacgcc
10 11 P 10 83 -1 4.11e-01 cctgtgg[ag]ca
7 2 C 7 41 0 8.77e-01 ggcaaca
7 4 R 7 4 0 8.77e-01 caacaac
7 12 P 7 147 0 8.77e-01 ctgtgga
7 38 P 7 93 0 8.77e-01 atgccgt
7 43 R 7 206 0 8.77e-01 gttgtcc
7 49 R 7 49 0 8.77e-01 cctgtcc
7 66 P 7 145 0 8.77e-01 gtggata
7 70 F 7 187 0 8.77e-01 ataacca
7 80 R 7 80 0 8.77e-01 ccgtgcc
7 115 C 7 171 0 8.77e-01 ctacaaa
7 172 P 7 182 0 8.77e-01 atgtttt
7 216 R 7 216 0 8.77e-01 aggagga
9 22 P 9 159 -1 1.48e+00 ag[ga]aacagt
9 29 P 9 66 -1 1.48e+00 gttatc[tc]ac
9 52 F 9 62 -1 1.48e+00 gtccg[at]gga
9 183 F 9 189 -1 1.48e+00 aa[ac]cataac
6 7 C 6 127 0 3.51e+00 caaccc
6 10 F 6 48 0 3.51e+00 ccctgt
6 10 R 6 45 0 3.51e+00 ccctgt
6 15 C 6 205 0 3.51e+00 tggaca
6 16 C 6 49 0 3.51e+00 ggacag
6 16 P 6 50 0 3.51e+00 ggacag
6 28 P 6 193 0 3.51e+00 agttat
6 39 R 6 39 0 3.51e+00 tgccgt
6 39 C 6 93 0 3.51e+00 tgccgt
6 55 R 6 219 0 3.51e+00 cgagga
6 57 F 6 90 0 3.51e+00 aggacg
6 68 P 6 136 0 3.51e+00 ggataa
6 72 R 6 72 0 3.51e+00 aaccaa
6 86 F 6 148 0 3.51e+00 ccacag
6 89 R 6 89 0 3.51e+00 caggac
6 93 R 6 93 0 3.51e+00 acggca
6 99 F 6 167 0 3.51e+00 tactga
6 102 F 6 211 0 3.51e+00 tgaaaa
6 116 R 6 183 0 3.51e+00 tacaaa
6 117 C 6 161 0 3.51e+00 acaaag
6 121 P 6 153 0 3.51e+00 aggggc
6 138 R 6 154 0 3.51e+00 atcccc
6 157 F 6 166 0 3.51e+00 ctactg
6 157 C 6 201 0 3.51e+00 ctactg
6 166 C 6 201 0 3.51e+00 ctactg
6 212 R 6 212 0 3.51e+00 gaaaag
6 218 R 6 218 0 3.51e+00 gaggag
8 11 F 8 206 -1 5.26e+00 cctgt[gt]ga
8 22 C 8 47 -1 5.26e+00 agg[ag]acag

Refseq NC_002939.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China