DoriC database

DoriC accession number ORI10010026
Organism Corynebacterium diphtheriae NCTC 13129
RefSeq NC_002935.1
Topology Circular
Lineage Bacteria, Actinobacteria, Actinobacteridae, Actinomycetales, Corynebacterineae, Corynebacteriaceae, Corynebacterium.
Chromosome size 2488635 nt
Chromosome GC content 0.5348
OriC length 942 nt
OriC AT content 0.5382
The number of DnaA box 7
The location of oriC region 2487712..18 nt
The location of dnaA gene 19..1677 nt
The extremes of GC disparity 2472075 nt (minimum), 1248032 nt (maximum)
Note -
OriC Sequence

ggtgaacactcctctaaattgttacaaggtgatatcgctgccggtgaccggctgcggtatcacccttgaattggatgattatcaaaacatagagagtcacacgccgcgctagtcacagtctcactagcggtgaaagtcttgacctcaacagggtcacaccgatgaacacgatgtgcatgctgagtcccttcgttcctggcggcactctcgttaaagcacttgcgattgacgtatatggtacgcccgttgcagtgacagacaacgaatagagtacgtgagcttgccccacttcaacaaatcgacacgccaatgagtcacacttacccctgtaatcgcaaatatgtaatttcacctttggttttccaagcgttggccggtcatcgacaatgaaatgacaaaaatcaacgttttctaccgtcagtaatccagccgcaatcacccccgcaccccacgtagcgcttttcacaagttggacaccgaaaaagacaaccgagtaacactacttgtgagaaaaaatcacatactgtgaaaaaccgtaccTGTGGATAActtttttatttttccaccgagTTTTCCACAaaaattacattcccgcaggtagaaccatacttttgggaatgaaattTTATCCACAgtgtgaaaaataaaaTGTGGATAActtttcacagtgagtcaacgtggattTTTTCCACAgcTGTGGAAAActctgtggaatacgcggtcaaagccgcaaaccagttgtggaaagttcagtggagttccggtggacgtcttgtggaaattacaaaaatTTATCCACCgcggattttcactccacatccccgcgctacgcggagattgttctgcgaatgcaatctcttcgtagctgccacaactggcgcacatcgtcgtcaatcattcgcttgaccttataaaggaagtacagtgtcggaaacgccatcc

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

20 684 P 20 684 0 2.27e-07 ttttccacagctgtggaaaa
19 560 P 19 695 -1 5.18e-05 ttccac[ca]gagttttccaca
14 540 F 14 649 0 9.30e-04 tgtggataactttt
12 567 P 12 695 0 1.49e-02 gagttttccaca
14 388 F 14 777 -1 3.90e-02 gaaat[gt]acaaaaat
14 541 P 14 785 -1 3.90e-02 gtggataa[ca]ttttt
14 548 R 14 551 -1 3.90e-02 ac[tc]tttttattttt
14 579 P 14 613 -1 3.90e-02 aaaatt[at]cattccc
11 552 P 11 638 0 5.95e-02 ttttatttttc
13 39 P 13 39 -1 1.45e-01 gccggt[gc]accggc
13 396 P 13 674 -1 1.45e-01 aaaaatc[ac]acgtt
13 620 F 13 786 -1 1.45e-01 aaa[ta]tttatccac
13 622 F 13 681 -1 1.45e-01 atttt[at]tccacag
13 636 R 13 640 -1 1.45e-01 gtg[at]aaaataaaa
13 650 P 13 786 -1 1.45e-01 gtggataa[ca]tttt
10 443 R 10 443 0 2.38e-01 gcaccccacg
10 522 P 10 659 0 2.38e-01 actgtgaaaa
10 539 P 10 625 0 2.38e-01 ctgtggataa
10 551 C 10 639 0 2.38e-01 tttttatttt
10 715 R 10 872 0 2.38e-01 acgcggtcaa
10 734 P 10 868 0 2.38e-01 ccagttgtgg
12 310 R 12 661 -1 5.36e-01 tgagt[cg]acactt
12 539 F 12 694 -1 5.36e-01 ctgtgga[ta]aact
12 556 F 12 789 -1 5.36e-01 attt[ta]tccaccg
12 685 P 12 735 -1 5.36e-01 tttccaca[ga]ctg
12 691 F 12 735 -1 5.36e-01 cag[ct]tgtggaaa
9 2 C 9 501 0 9.52e-01 tgaacactc
9 93 F 9 311 0 9.52e-01 gagtcacac
9 160 C 9 499 0 9.52e-01 gatgaacac
9 167 P 9 879 0 9.52e-01 acgatgtgc
9 313 C 9 632 0 9.52e-01 gtcacactt
9 340 P 9 580 0 9.52e-01 atgtaattt
9 341 P 9 777 0 9.52e-01 tgtaatttc
9 458 F 9 658 0 9.52e-01 cttttcaca
9 509 P 9 680 0 9.52e-01 gaaaaaatc
9 524 F 9 635 0 9.52e-01 tgtgaaaaa
9 557 F 9 683 0 9.52e-01 tttttccac
9 570 F 9 684 0 9.52e-01 ttttccaca
9 571 P 9 738 0 9.52e-01 tttccacaa
9 571 P 9 772 0 9.52e-01 tttccacaa
9 576 F 9 783 0 9.52e-01 acaaaaatt
9 624 F 9 790 0 9.52e-01 tttatccac
9 625 P 9 649 0 9.52e-01 ttatccaca
9 738 F 9 772 0 9.52e-01 ttgtggaaa
11 27 P 11 53 -1 1.96e+00 ggtgata[tc]cgc
11 41 P 11 372 -1 1.96e+00 cg[ga]tgaccggc
11 448 P 11 823 -1 1.96e+00 cc[ag]cgtagcgc
11 459 P 11 501 -1 1.96e+00 tt[tc]tcacaagt
11 511 F 11 578 -1 1.96e+00 aaaaat[ct]acat
11 523 F 11 694 -1 1.96e+00 ctgtg[ag]aaaac

Refseq NC_002935.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China