DoriC

DoriC accession number	ORI10010016
Organism	Staphylococcus aureus subsp. aureus N315
RefSeq	NC_002745.1
Topology	Circular
Lineage	Bacteria, Firmicutes, Bacillales, Staphylococcus.
Chromosome size	2814816 nt
Chromosome GC content	0.3284
OriC length	277 nt
OriC AT content	0.704
The number of DnaA box	4
The location of oriC region	1879..2155 nt
The location of dnaA gene	517..1878 nt
The extremes of GC disparity	270 nt (minimum), 1407785 nt (maximum)
Note	Dif-like sequence acttcctataatatatattatgtaaact (-1 chain) was found between 1382876 and 1382903 nt, matches 27 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
DnaA-trio	The oriC contains the DnaA-trio element (3'-GTTAGGTGTCGTGGATGATGATAATGAT-5') retrieved by BLAST. Please refer to Richardson T.T. et al 2016 (Nature 534.7607: 412) fro more details.
OriC Sequence	gtaggaaactttgggaaatgtaatctgttatataacagcactaataataactgtcattttttacatttctatatactaatgtgacaagatgagcaaaactcatttTGTGGATAAtgtttaaaagtcatacacaccatacacaagTTATCAACATGTGTATAActtcgccaaatctatgtttttacgacTTATCCACCaatccacagcacctactactattactaagaacttaaaacctatataattatatataaacgactggaaggagttttaatta
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 14 24 P 14 24 0 8.04e-05 ctgttatataacag 14 237 P 14 237 0 8.04e-05 tatataattatata 10 54 R 10 54 0 2.06e-02 cattttttac 10 244 P 10 244 0 2.06e-02 ttatatataa 12 121 P 12 153 -1 4.63e-02 aagt[ct]atacaca 12 147 R 12 152 -1 4.63e-02 tcaa[ct]atgtgta 9 14 P 9 60 0 8.23e-02 gaaatgtaa 9 59 R 9 59 0 8.23e-02 tttacattt 11 69 R 11 241 -1 1.70e-01 tatata[ct]taat 11 103 P 11 188 -1 1.70e-01 tt[tg]gtggataa 11 135 P 11 149 -1 1.70e-01 atacaca[at]gtt 8 15 C 8 59 0 3.29e-01 aaatgtaa 8 42 R 8 42 0 3.29e-01 aataataa 8 125 F 8 134 0 3.29e-01 catacaca 10 38 R 10 41 -1 6.17e-01 ca[ca]taataat 10 65 P 10 245 -1 6.17e-01 ttt[ca]tatata 10 70 C 10 237 -1 6.17e-01 atata[ct]taat 10 83 P 10 98 -1 6.17e-01 acaa[ga]atgag 10 89 C 10 97 -1 6.17e-01 tgag[ct]aaaac 10 94 P 10 262 -1 6.17e-01 aaaactc[ac]tt 10 101 R 10 263 -1 6.17e-01 attttg[ta]gga 10 106 C 10 206 -1 6.17e-01 gtggat[ag]atg 10 109 C 10 215 -1 6.17e-01 gataatg[ta]tt 10 144 R 10 210 -1 6.17e-01 ttatca[at]cat 10 242 R 10 245 -1 6.17e-01 aa[ta]tatatat 7 16 R 7 16 0 1.32e+00 aatgtaa 7 18 R 7 75 0 1.32e+00 tgtaatc 7 27 F 7 244 0 1.32e+00 ttatata 7 27 P 7 237 0 1.32e+00 ttatata 7 27 P 7 247 0 1.32e+00 ttatata 7 28 F 7 247 0 1.32e+00 tatataa 7 28 F 7 237 0 1.32e+00 tatataa 7 28 P 7 244 0 1.32e+00 tatataa 7 34 F 7 202 0 1.32e+00 acagcac 7 49 R 7 49 0 1.32e+00 actgtca 7 53 F 7 99 0 1.32e+00 tcatttt 7 54 R 7 178 0 1.32e+00 cattttt 7 57 F 7 178 0 1.32e+00 tttttac 7 68 F 7 236 0 1.32e+00 ctatata 7 105 P 7 198 0 1.32e+00 tgtggat 7 126 P 7 153 0 1.32e+00 atacaca 7 141 P 7 158 0 1.32e+00 aagttat 7 229 P 7 267 0 1.32e+00 ttaaaac 7 237 F 7 247 0 1.32e+00 tatataa 7 245 C 7 246 0 1.32e+00 tatatat 7 246 R 7 246 0 1.32e+00 atatata 9 4 R 9 115 -1 2.22e+00 gaaa[ca]tttg 9 66 F 9 244 -1 2.22e+00 tt[ca]tatata 9 93 R 9 227 -1 2.22e+00 caaaa[ct]tca 9 94 F 9 119 -1 2.22e+00 aaaa[cg]tcat

Refseq	NC_002745.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2