DoriC accession number | ORI10010011 |
Organism | Bacillus halodurans C-125 |
RefSeq | NC_002570.1 |
Topology | Circular |
Lineage | Bacteria, Firmicutes, Bacillales, Bacillaceae, Bacillus. |
Chromosome size | 4202352 nt |
Chromosome GC content | 0.4369 |
OriC length | 597 nt |
OriC AT content | 0.6583 |
The number of DnaA box | 9 |
The location of oriC region | 4202339..583 nt |
The location of dnaA gene | 584..1933 nt |
The extremes of GC disparity | 2185 nt (minimum), 2242483 nt (maximum) |
Note | Dif-like sequence ggttcctataatatatattatgtaaact (1 chain) was found between 2243235 and 2243262 nt, matches 25 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis. |
OriC Sequence | ttataacacctccctgaggactttgaggattttgtcatcatcaaaagacattcttgtaaattatatgaaacgtcggtttccttgtcaagattcgttttttgtaaatgatctccttagtctattttacaacaacatcacTGTGGATAAcatCTATCCACAcacaaaagcatgtcctcaaacTTATCGACAgattacacacatgatcttgtgtTGTGGATAAaaaacaaacacagcatattgaacctTGTGGATAAatagctagaacccttgcaactacttattttttttgctaagatattattgttttacacgtggatgcctattttgaacgtcaattaTTATCCACAcgcTGTGTATAActttgtggacagttgtttacgaccTTATCCACAcaggtgtgattcgtgttcattcgacgtttttctactatattatattCTATCCACAtcgtttttcagaatttcatatttattcatcactatacacactaggtatacatacgttgtacagcctagtctttcttttcttctactaaccttataaacaaatggctgtagtctgtagtttatttttttaaagaataggagggagcaacgg |
The information of repeat |
The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 11 124 R 11 124 0 2.39e-02 tacaacaacat |
Refseq | NC_002570.1 |
Legend | Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters. |
![]() |
|
![]() |