DoriC database

DoriC accession number ORI10010011
Organism Bacillus halodurans C-125
RefSeq NC_002570.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Bacillaceae, Bacillus.
Chromosome size 4202352 nt
Chromosome GC content 0.4369
OriC length 597 nt
OriC AT content 0.6583
The number of DnaA box 9
The location of oriC region 4202339..583 nt
The location of dnaA gene 584..1933 nt
The extremes of GC disparity 2185 nt (minimum), 2242483 nt (maximum)
Note Dif-like sequence ggttcctataatatatattatgtaaact (1 chain) was found between 2243235 and 2243262 nt, matches 25 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

ttataacacctccctgaggactttgaggattttgtcatcatcaaaagacattcttgtaaattatatgaaacgtcggtttccttgtcaagattcgttttttgtaaatgatctccttagtctattttacaacaacatcacTGTGGATAAcatCTATCCACAcacaaaagcatgtcctcaaacTTATCGACAgattacacacatgatcttgtgtTGTGGATAAaaaacaaacacagcatattgaacctTGTGGATAAatagctagaacccttgcaactacttattttttttgctaagatattattgttttacacgtggatgcctattttgaacgtcaattaTTATCCACAcgcTGTGTATAActttgtggacagttgtttacgaccTTATCCACAcaggtgtgattcgtgttcattcgacgtttttctactatattatattCTATCCACAtcgtttttcagaatttcatatttattcatcactatacacactaggtatacatacgttgtacagcctagtctttcttttcttctactaaccttataaacaaatggctgtagtctgtagtttatttttttaaagaataggagggagcaacgg

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

11 124 R 11 124 0 2.39e-02 tacaacaacat
11 210 F 11 244 0 2.39e-02 ttgtggataaa
11 272 R 11 467 0 2.39e-02 actacttattt
13 87 R 13 282 -1 5.83e-02 aga[ta]tcgtttttt
10 149 F 10 437 0 9.56e-02 tctatccaca
10 151 F 10 384 0 9.56e-02 tatccacaca
10 277 F 10 565 0 9.56e-02 ttattttttt
10 338 F 10 383 0 9.56e-02 ttatccacac
10 427 R 10 427 0 9.56e-02 tatattatat
10 518 R 10 518 0 9.56e-02 ttcttttctt
12 91 R 12 279 -1 2.15e-01 tcgtttttt[gt]ta
12 211 P 12 335 -1 2.15e-01 tgtggataa[at]aa
12 426 R 12 431 -1 2.15e-01 ctat[ac]ttatatt
9 138 F 9 211 0 3.82e-01 tgtggataa
9 138 F 9 245 0 3.82e-01 tgtggataa
9 138 P 9 383 0 3.82e-01 tgtggataa
9 138 P 9 338 0 3.82e-01 tgtggataa
9 151 F 9 339 0 3.82e-01 tatccacac
9 192 R 9 192 0 3.82e-01 tacacacat
9 211 P 9 383 0 3.82e-01 tgtggataa
9 233 C 9 353 0 3.82e-01 catattgaa
9 245 P 9 383 0 3.82e-01 tgtggataa
9 245 P 9 338 0 3.82e-01 tgtggataa
9 249 R 9 249 0 3.82e-01 gataaatag
9 283 R 9 446 0 3.82e-01 tttttgcta
9 540 R 9 540 0 3.82e-01 taaacaaat
9 567 R 9 567 0 3.82e-01 attttttta
11 14 F 11 23 -1 7.89e-01 tgagga[ct]tttg
11 41 C 11 93 -1 7.89e-01 caaaa[ga]acatt
11 50 F 11 95 -1 7.89e-01 tt[ct]ttgtaaat
11 114 F 11 561 -1 7.89e-01 tagt[ct]tatttt
11 137 F 11 349 -1 7.89e-01 ctgtg[gt]ataac
11 148 P 11 245 -1 7.89e-01 at[ct]tatccaca
11 155 R 11 220 -1 7.89e-01 caca[ca]acaaaa
11 211 P 11 436 -1 7.89e-01 tgtggata[ag]aa
11 213 C 11 275 -1 7.89e-01 tg[ga]ataaaaaa
11 218 P 11 563 -1 7.89e-01 aaaaaa[ct]aaac
11 240 F 11 357 -1 7.89e-01 aac[ct]ttgtgga
11 297 F 11 565 -1 7.89e-01 ttatt[gt]tttta
11 360 R 11 366 -1 7.89e-01 tttgt[gt]gacag
11 418 F 11 523 -1 7.89e-01 tt[tc]ttctacta
8 21 P 8 171 0 1.53e+00 tttgagga
8 62 P 8 460 0 1.53e+00 atatgaaa
8 67 P 8 413 0 1.53e+00 aaacgtcg
8 91 F 8 447 0 1.53e+00 tcgttttt
8 93 R 8 93 0 1.53e+00 gttttttg
8 94 C 8 218 0 1.53e+00 ttttttgt
8 138 P 8 439 0 1.53e+00 tgtggata
8 138 P 8 151 0 1.53e+00 tgtggata
8 151 P 8 211 0 1.53e+00 tatccaca

Refseq NC_002570.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China