DoriC database

DoriC accession number ORI10010010
Organism Pseudomonas aeruginosa PAO1
RefSeq NC_002516.1
Topology Circular
Lineage Bacteria, Proteobacteria, Gammaproteobacteria, Pseudomonadales, Pseudomonadaceae, Pseudomonas.
Chromosome size 6264403 nt
Chromosome GC content 0.6656
OriC length 525 nt
OriC AT content 0.4838
The number of DnaA box 5
The location of oriC region 6264361..482 nt
The location of dnaA gene 483..2027 nt
The extremes of GC disparity 6242446 nt (minimum), 2428794 nt (maximum)
Note Dif-like sequence gattcgcataatgtatattatgttaaat (-1 chain) was found between 2443068 and 2443095 nt, matches 26 sites compared with the 28-bp dif sequence ggtgcgcataatgtatattatgttaaat of E. coli.
OriC Sequence

gattcggtacctgggttgacgacttgaggtcgcagtgaccccgtttaaagagaccggcgattctagtgaaatcgaacgggcaggtcaatttccaaccagcgatgacgtaatagatagatacaaggaagtcatttttcttttaaaggatagaaacggttaatgctcttgggacggcgcttttcTGTGCATAActcgatgaagcccagcaattgcgtgtttctccggcaggcaaaaggttgtcgagaaccggtgtcgaggctgtttccttcctgagcgaagcctggggatgaacgagatggTTATCCACAgcggttTTTTCCACAcggctgtgcgcagggatgtacccccttcaaagcaagggTTATCCACAaagtccaggacgaccgtccgtcggcctgcctgcttttattaaggtcttgatttgcttggggcctcagcgcatcggcaTGTGGATAAgtccggcccgtccggctacaataggcgcttatttcgttgtgccgcctttccaatctttgggggatatcc

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

11 109 R 11 109 0 1.85e-02 atagatagata
11 297 F 11 359 0 1.85e-02 ggttatccaca
13 141 C 13 502 -1 4.51e-02 aaagg[at]tagaaac
10 390 R 10 463 0 7.39e-02 tcggcctgcc
9 132 R 9 132 0 2.96e-01 ttttctttt
9 299 P 9 447 0 2.96e-01 ttatccaca
9 361 P 9 447 0 2.96e-01 ttatccaca
11 181 P 11 298 -1 6.10e-01 ctgtg[cg]ataac
8 76 C 8 461 0 1.18e+00 cgggcagg
8 88 C 8 231 0 1.18e+00 tttccaac
8 161 C 8 240 0 1.18e+00 gctcttgg
8 205 P 8 205 0 1.18e+00 gcaattgc
8 223 C 8 383 0 1.18e+00 ggcaggca
8 263 R 8 263 0 1.18e+00 tccttcct
8 384 R 8 395 0 1.18e+00 cgtccgtc
8 517 P 8 517 0 1.18e+00 ggatatcc
10 46 C 10 216 -1 2.22e+00 aaagag[ag]ccg
10 182 P 10 360 -1 2.22e+00 tgtg[cg]ataac
10 260 C 10 350 -1 2.22e+00 gtttc[cg]ttcc
10 380 R 10 393 -1 2.22e+00 cg[at]ccgtccg
10 439 R 10 465 -1 2.22e+00 catcggc[ac]tg
7 32 R 7 32 0 4.73e+00 cagtgac
7 43 F 7 138 0 4.73e+00 tttaaag
7 75 R 7 75 0 4.73e+00 acgggca
7 86 C 7 139 0 4.73e+00 aatttcc
7 88 F 7 502 0 4.73e+00 tttccaa
7 109 R 7 109 0 4.73e+00 atagata
7 109 F 7 113 0 4.73e+00 atagata
7 113 R 7 113 0 4.73e+00 atagata
7 121 C 7 262 0 4.73e+00 aaggaag
7 147 C 7 508 0 4.73e+00 tagaaac
7 168 R 7 222 0 4.73e+00 ggacggc
7 172 F 7 479 0 4.73e+00 ggcgctt
7 213 C 7 366 0 4.73e+00 gtgtttc
7 223 C 7 463 0 4.73e+00 ggcaggc
7 223 P 7 393 0 4.73e+00 ggcaggc
7 224 P 7 396 0 4.73e+00 gcaggca
7 230 C 7 314 0 4.73e+00 aaaaggt
7 231 C 7 502 0 4.73e+00 aaaggtt
7 237 F 7 250 0 4.73e+00 tgtcgag
7 248 C 7 303 0 4.73e+00 ggtgtcg
7 298 C 7 474 0 4.73e+00 gttatcc
7 320 C 7 493 0 4.73e+00 acacggc
7 342 C 7 513 0 4.73e+00 accccct
7 351 C 7 487 0 4.73e+00 aaagcaa
7 360 C 7 474 0 4.73e+00 gttatcc
7 383 F 7 463 0 4.73e+00 ccgtccg
7 391 R 7 456 0 4.73e+00 cggcctg
7 456 F 7 465 0 4.73e+00 gtccggc
7 500 R 7 500 0 4.73e+00 cctttcc

Refseq NC_002516.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China