DoriC database

DoriC accession number ORI10010009
Organism Xylella fastidiosa 9a5c
RefSeq NC_002488.1
Topology Circular
Lineage Bacteria, Proteobacteria, Gammaproteobacteria, Xanthomonadales, Xanthomonadaceae, Xylella.
Chromosome size 2679306 nt
Chromosome GC content 0.5267
OriC length 296 nt
OriC AT content 0.7196
The number of DnaA box 3
The location of oriC region 1463..1758 nt
The location of dnaA gene 143..1462 nt
The extremes of GC disparity 1892 nt (minimum), 1784812 nt (maximum)
Note -
OriC Sequence

ctcccctacttttttatatgactactcattttctatagaaatgtaaaaataaattaattctttccaaggaagtgtaaaaaactTGTGGATAAaataagatttaaatttttataaaaatTTATCCACAgattttccagatgatctaagcacaataacttaggatcttatacagagaaaaataacaaattaaacaacatcttagagcacTTCTCCACAaaaaaatttctaccaccaccaccaccaccaccaccataagttttaaatattaactaaaaagcatagaggtaaggaacaaa

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

27 226 R 27 226 0 1.37e-12 taccaccaccaccaccaccaccaccat
22 227 F 22 230 0 1.40e-09 accaccaccaccaccaccacca
22 227 R 22 227 0 1.40e-09 accaccaccaccaccaccacca
22 230 R 22 230 0 1.40e-09 accaccaccaccaccaccacca
20 101 P 20 101 0 2.24e-08 taaatttttataaaaattta
19 227 F 19 233 0 8.96e-08 accaccaccaccaccacca
19 227 R 19 227 0 8.96e-08 accaccaccaccaccacca
19 233 R 19 233 0 8.96e-08 accaccaccaccaccacca
16 227 F 16 236 0 5.74e-06 accaccaccaccacca
16 227 R 16 227 0 5.74e-06 accaccaccaccacca
16 236 R 16 236 0 5.74e-06 accaccaccaccacca
14 180 R 14 180 0 9.18e-05 aacaaattaaacaa
13 227 F 13 239 0 3.67e-04 accaccaccacca
13 227 R 13 227 0 3.67e-04 accaccaccacca
13 239 R 13 239 0 3.67e-04 accaccaccacca
12 29 P 12 29 0 1.47e-03 tttctatagaaa
13 34 R 13 38 -1 1.43e-02 ata[ga]aaatgtaaa
13 38 C 13 99 -1 1.43e-02 aaat[gt]taaaaata
13 93 F 13 251 -1 1.43e-02 ataag[at]tttaaat
10 83 P 10 117 0 2.35e-02 tgtggataaa
10 227 F 10 242 0 2.35e-02 accaccacca
10 227 R 10 227 0 2.35e-02 accaccacca
10 242 R 10 242 0 2.35e-02 accaccacca
12 37 F 12 68 -1 5.29e-02 gaa[ag]tgtaaaaa
12 44 R 12 264 -1 5.29e-02 aaaaat[ac]aatta
9 99 R 9 99 0 9.40e-02 tttaaattt
9 113 C 9 256 0 9.40e-02 aaaatttat
11 6 C 11 40 -1 1.94e-01 tac[ta]tttttat
11 40 R 11 110 -1 1.94e-01 at[gt]taaaaata
11 77 P 11 249 -1 1.94e-01 aaaactt[ga]tgg
11 94 P 11 257 -1 1.94e-01 taa[gt]atttaaa
11 95 P 11 98 -1 1.94e-01 aa[ga]atttaaat
8 10 F 8 105 0 3.76e-01 tttttata
8 10 P 8 109 0 3.76e-01 tttttata
8 41 F 8 72 0 3.76e-01 tgtaaaaa
8 43 C 8 104 0 3.76e-01 taaaaata
8 44 F 8 174 0 3.76e-01 aaaaataa
8 51 P 8 51 0 3.76e-01 aattaatt
8 88 R 8 88 0 3.76e-01 ataaaata
8 101 R 8 256 0 3.76e-01 taaatttt
8 102 P 8 217 0 3.76e-01 aaattttt
8 112 F 8 217 0 3.76e-01 aaaaattt
10 47 F 10 180 -1 7.05e-01 aa[tc]aaattaa
10 47 R 10 184 -1 7.05e-01 aa[tc]aaattaa
10 82 P 10 207 -1 7.05e-01 ttgtgga[tg]aa
10 99 F 10 257 -1 7.05e-01 tttaaat[ta]tt
10 105 C 10 215 -1 7.05e-01 ttttt[at]taaa
10 107 R 10 215 -1 7.05e-01 ttta[ta]aaaaa
10 218 C 10 256 -1 7.05e-01 aaaattt[ca]ta
7 9 C 7 216 0 1.50e+00 tttttta

Refseq NC_002488.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China