DoriC database

DoriC accession number ORI10010006
Organism Bacillus subtilis subsp. subtilis str. 168
RefSeq NC_000964.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Bacillaceae, Bacillus.
Chromosome size 4214630 nt
Chromosome GC content 0.4352
OriC length 626 nt
OriC AT content 0.647
The number of DnaA box 8
The location of oriC region 4214414..409 nt
The location of dnaA gene 410..1750 nt
The extremes of GC disparity 4214620 nt (minimum), 1941646 nt (maximum)
Note Here the oriC region has been confirmed by experiment. Please refer to Moriya S. et al. 1992 (Mol Microbiol. 6(3):309-15) for more details. Dif-like sequence acttcctagaatatatattatgtaaact (1 chain) was found between 1941752 and 1941779 nt, matches 28 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
OriC Sequence

ttatgacacctccctcgaggaatagctgttaaagacagtcttacttattatatttgcgttacctattcattgtcaacttcactagtgcttttatttcttgcaaccataataggataccataccttttcaactttcgaaaccttattttttagattccttaattttacggaaaaaagacaaattcaaacaatttgcccctaaaatcacgcaTGTGGATATctttttcggctttttttaGTATCCACAgaggTTATCGACAacattttcacattaccaaccccTGTGGACAAggttttttcaacaggttgtccgcttTGTGGATAAgattgtgacaaccattgcaagctctcgtttattttggtattatatttgtgttttaactcttgattactaatcctacctttcctctTTATCCACAaagTGTGGATAAgttgtggattgatttcacacagcttgtgtagaaggTTGTCCACAagttgtgaaatttgtcgaaaagctatttatctactatattatatgttttcaacatttaatgtgtacgaatggtaagcgccatttgctctttttttgtgttctataacagagaaagacgccattttctaagaaaaggagggacgtgccggaag

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

17 217 R 17 220 -1 3.27e-04 at[ct]tttttcggcttttt
15 45 F 15 361 -1 4.62e-03 tattatatttg[ct]gtt
15 483 R 15 488 -1 4.62e-03 attt[ga]tcgaaaagct
12 312 P 12 409 0 6.57e-03 ctttgtggataa
12 539 R 12 539 0 6.57e-03 cgaatggtaagc
13 595 P 13 595 -1 6.41e-02 ttttct[at]agaaaa
10 20 C 10 250 0 1.05e-01 aatagctgtt
10 101 C 10 357 0 1.05e-01 aaccataata
10 124 R 10 124 0 1.05e-01 tttcaacttt
10 315 F 10 421 0 1.05e-01 tgtggataag
10 508 R 10 508 0 1.05e-01 tatattatat
12 240 P 12 275 -1 2.36e-01 tccacag[ag]ggtt
9 60 C 9 423 0 4.20e-01 acctattca
9 281 P 9 465 0 4.20e-01 tgtggacaa
9 294 F 9 519 0 4.20e-01 ttttcaaca
9 302 F 9 462 0 4.20e-01 aggttgtcc
9 346 R 9 554 0 4.20e-01 tctcgttta
9 368 R 9 368 0 4.20e-01 tttgtgttt
9 369 R 9 565 0 4.20e-01 ttgtgtttt
9 409 P 9 421 0 4.20e-01 ttatccaca
9 496 R 9 496 0 4.20e-01 ctatttatc
11 19 R 11 314 -1 8.67e-01 gaatag[cg]tgtt
11 19 R 11 485 -1 8.67e-01 gaa[ta]agctgtt
11 31 P 11 31 -1 8.67e-01 aagac[at]gtctt
11 85 R 11 351 -1 8.67e-01 tg[cg]ttttattt
11 120 C 11 423 -1 8.67e-01 acct[ta]ttcaac
11 123 F 11 519 -1 8.67e-01 ttttcaac[ta]tt
11 123 R 11 520 -1 8.67e-01 ttt[ta]caacttt
11 165 R 11 168 -1 8.67e-01 ac[ga]gaaaaaag
11 169 C 11 563 -1 8.67e-01 aaaaaa[gc]acaa
11 171 P 11 367 -1 8.67e-01 aaaa[gc]acaaat
11 238 F 11 410 -1 8.67e-01 tatccaca[ga]ag
11 238 P 11 312 -1 8.67e-01 tatccaca[ga]ag
11 255 R 11 293 -1 8.67e-01 gacaac[at]tttt
11 267 R 11 332 -1 8.67e-01 ac[ag]ttaccaac
11 295 C 11 461 -1 8.67e-01 tt[tc]caacaggt
11 368 F 11 566 -1 8.67e-01 tttgtgtt[tc]ta
11 385 P 11 385 -1 8.67e-01 gatta[cg]taatc
11 447 P 11 470 -1 8.67e-01 caca[ga]cttgtg
11 470 P 11 470 -1 8.67e-01 cacaa[gc]ttgtg
11 525 P 11 525 -1 8.67e-01 acatt[ta]aatgt
11 550 F 11 590 -1 8.67e-01 cgccattt[gt]ct
8 12 P 8 12 0 1.68e+00 cctcgagg
8 40 R 8 63 0 1.68e+00 ttacttat
8 45 R 8 508 0 1.68e+00 tattatat
8 45 F 8 510 0 1.68e+00 tattatat
8 60 C 8 317 0 1.68e+00 acctattc
8 79 P 8 79 0 1.68e+00 cactagtg
8 108 R 8 108 0 1.68e+00 ataggata
8 113 R 8 113 0 1.68e+00 ataccata

Refseq NC_000964.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China