DoriC

DoriC accession number	ORI10010005
Organism	Bacillus subtilis subsp. subtilis str. 168
RefSeq	NC_000964.1
Topology	Circular
Lineage	Bacteria, Firmicutes, Bacillales, Bacillaceae, Bacillus.
Chromosome size	4214630 nt
Chromosome GC content	0.4352
OriC length	188 nt
OriC AT content	0.6277
The number of DnaA box	3
The location of oriC region	1751..1938 nt
The location of dnaA gene	410..1750 nt
The extremes of GC disparity	4214620 nt (minimum), 1941646 nt (maximum)
Note	Here the oriC region has been confirmed by experiment. Please refer to Moriya S. et al. 1992 (Mol Microbiol. 6(3):309-15) for more details. Dif-like sequence acttcctagaatatatattatgtaaact (1 chain) was found between 1941752 and 1941779 nt, matches 28 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
DnaA-trio	The oriC contains the DnaA-trio element (3'-TTTAGGTGTCCGGGATGATAATGAAGATGAT-5') retrieved by BLAST. Please refer to Richardson T.T. et al 2016 (Nature 534.7607: 412) for more details.
OriC Sequence	caggaccggggatcaatcggggaaagTGTGAATAActtttcggaagtcatacacagtctgtccacaTGTGGATAGgctgtgtttcctgtctttttcacaacTTATCCACAaatccacaggccctactattacttctactattttttataaatatatatattaatacattatccgttaggaggataaaa
The information of repeat	The following lines contain repeats found, one line each. [1] - repeat length of the first part [2] - starting position of the first part [4] - repeat length of the second part [5] - starting position of the second part [6] - distance of this repeat [7] - calculated evalue of this repeat [8] - repeat sequence For more details, please refer to The Manual of REPuter. 16 145 P 16 149 -1 1.11e-04 tat[at]aatatatatatt 15 57 P 15 60 -1 4.17e-04 ct[ga]tccacatgtgga 14 146 R 14 151 -1 1.56e-03 ataa[at]tatatatat 10 138 R 10 138 0 9.48e-03 tattttttat 12 143 C 12 148 -1 2.13e-02 tttata[at]atata 9 23 R 9 23 0 3.79e-02 aagtgtgaa 9 145 R 9 145 0 3.79e-02 tataaatat 9 150 R 9 150 0 3.79e-02 atatatata 9 150 C 9 151 0 3.79e-02 atatatata 9 175 R 9 175 0 3.79e-02 taggaggat 11 144 R 11 150 -1 7.82e-02 ttata[at]atata 11 154 P 11 157 -1 7.82e-02 at[ag]tattaata 8 66 P 8 102 0 1.52e-01 tgtggata 8 122 F 8 134 0 1.52e-01 ctactatt 8 143 P 8 143 0 1.52e-01 tttataaa 8 150 F 8 152 0 1.52e-01 atatatat 8 150 P 8 150 0 1.52e-01 atatatat 8 152 P 8 152 0 1.52e-01 atatatat 10 134 C 10 178 -1 2.84e-01 ct[ac]ctatttt 10 146 F 10 150 -1 2.84e-01 ata[at]atatat 10 146 P 10 150 -1 2.84e-01 ata[at]atatat 10 147 R 10 150 -1 2.84e-01 ta[at]atatata 10 147 C 10 150 -1 2.84e-01 ta[at]atatata 7 22 C 7 92 0 6.07e-01 aaagtgt 7 56 R 7 84 0 6.07e-01 tctgtcc 7 66 P 7 111 0 6.07e-01 tgtggat 7 69 R 7 69 0 6.07e-01 ggatagg 7 89 R 7 89 0 6.07e-01 ctttttc 7 103 F 7 111 0 6.07e-01 atccaca 7 125 R 7 165 0 6.07e-01 ctattac 7 153 R 7 153 0 6.07e-01 tatatat 9 26 P 9 90 -1 1.02e+00 tgtgaa[ta]aa 9 26 P 9 101 -1 1.02e+00 tgtg[ag]ataa 9 42 P 9 126 -1 1.02e+00 gaagt[ca]ata 9 50 P 9 73 -1 1.02e+00 acacag[tc]ct 9 52 P 9 52 -1 1.02e+00 acag[ta]ctgt 9 81 R 9 85 -1 1.02e+00 ttt[ct]ctgtc 9 121 C 9 177 -1 1.02e+00 cct[ac]ctatt 9 145 F 9 151 -1 1.02e+00 tata[at]atat 9 145 C 9 156 -1 1.02e+00 tataa[at]tat 9 145 P 9 150 -1 1.02e+00 tata[at]atat 6 0 R 6 0 0 2.43e+00 caggac 6 6 F 6 17 0 2.43e+00 cgggga 6 28 C 6 99 0 2.43e+00 tgaata 6 34 R 6 91 0 2.43e+00 actttt 6 35 R 6 35 0 2.43e+00 cttttc 6 60 F 6 104 0 2.43e+00 tccaca 6 60 F 6 112 0 2.43e+00 tccaca 6 71 C 6 168 0 2.43e+00 ataggc 6 78 C 6 106 0 2.43e+00 gtgttt

Refseq	NC_000964.1
Legend	Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
	Figure 1
	Figure 2