DoriC database

DoriC accession number ORI10010005
Organism Bacillus subtilis subsp. subtilis str. 168
RefSeq NC_000964.1
Topology Circular
Lineage Bacteria, Firmicutes, Bacillales, Bacillaceae, Bacillus.
Chromosome size 4214630 nt
Chromosome GC content 0.4352
OriC length 188 nt
OriC AT content 0.6277
The number of DnaA box 3
The location of oriC region 1751..1938 nt
The location of dnaA gene 410..1750 nt
The extremes of GC disparity 4214620 nt (minimum), 1941646 nt (maximum)
Note Here the oriC region has been confirmed by experiment. Please refer to Moriya S. et al. 1992 (Mol Microbiol. 6(3):309-15) for more details. Dif-like sequence acttcctagaatatatattatgtaaact (1 chain) was found between 1941752 and 1941779 nt, matches 28 sites compared with the 28-bp dif sequence acttcctagaatatatattatgtaaact of B. subtilis.
DnaA-trio The oriC contains the DnaA-trio element (3'-TTTAGGTGTCCGGGATGATAATGAAGATGAT-5') retrieved by BLAST. Please refer to Richardson T.T. et al 2016 (Nature 534.7607: 412) for more details.
OriC Sequence

caggaccggggatcaatcggggaaagTGTGAATAActtttcggaagtcatacacagtctgtccacaTGTGGATAGgctgtgtttcctgtctttttcacaacTTATCCACAaatccacaggccctactattacttctactattttttataaatatatatattaatacattatccgttaggaggataaaa

The information of repeat
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

16 145 P 16 149 -1 1.11e-04 tat[at]aatatatatatt
15 57 P 15 60 -1 4.17e-04 ct[ga]tccacatgtgga
14 146 R 14 151 -1 1.56e-03 ataa[at]tatatatat
10 138 R 10 138 0 9.48e-03 tattttttat
12 143 C 12 148 -1 2.13e-02 tttata[at]atata
9 23 R 9 23 0 3.79e-02 aagtgtgaa
9 145 R 9 145 0 3.79e-02 tataaatat
9 150 R 9 150 0 3.79e-02 atatatata
9 150 C 9 151 0 3.79e-02 atatatata
9 175 R 9 175 0 3.79e-02 taggaggat
11 144 R 11 150 -1 7.82e-02 ttata[at]atata
11 154 P 11 157 -1 7.82e-02 at[ag]tattaata
8 66 P 8 102 0 1.52e-01 tgtggata
8 122 F 8 134 0 1.52e-01 ctactatt
8 143 P 8 143 0 1.52e-01 tttataaa
8 150 F 8 152 0 1.52e-01 atatatat
8 150 P 8 150 0 1.52e-01 atatatat
8 152 P 8 152 0 1.52e-01 atatatat
10 134 C 10 178 -1 2.84e-01 ct[ac]ctatttt
10 146 F 10 150 -1 2.84e-01 ata[at]atatat
10 146 P 10 150 -1 2.84e-01 ata[at]atatat
10 147 R 10 150 -1 2.84e-01 ta[at]atatata
10 147 C 10 150 -1 2.84e-01 ta[at]atatata
7 22 C 7 92 0 6.07e-01 aaagtgt
7 56 R 7 84 0 6.07e-01 tctgtcc
7 66 P 7 111 0 6.07e-01 tgtggat
7 69 R 7 69 0 6.07e-01 ggatagg
7 89 R 7 89 0 6.07e-01 ctttttc
7 103 F 7 111 0 6.07e-01 atccaca
7 125 R 7 165 0 6.07e-01 ctattac
7 153 R 7 153 0 6.07e-01 tatatat
9 26 P 9 90 -1 1.02e+00 tgtgaa[ta]aa
9 26 P 9 101 -1 1.02e+00 tgtg[ag]ataa
9 42 P 9 126 -1 1.02e+00 gaagt[ca]ata
9 50 P 9 73 -1 1.02e+00 acacag[tc]ct
9 52 P 9 52 -1 1.02e+00 acag[ta]ctgt
9 81 R 9 85 -1 1.02e+00 ttt[ct]ctgtc
9 121 C 9 177 -1 1.02e+00 cct[ac]ctatt
9 145 F 9 151 -1 1.02e+00 tata[at]atat
9 145 C 9 156 -1 1.02e+00 tataa[at]tat
9 145 P 9 150 -1 1.02e+00 tata[at]atat
6 0 R 6 0 0 2.43e+00 caggac
6 6 F 6 17 0 2.43e+00 cgggga
6 28 C 6 99 0 2.43e+00 tgaata
6 34 R 6 91 0 2.43e+00 actttt
6 35 R 6 35 0 2.43e+00 cttttc
6 60 F 6 104 0 2.43e+00 tccaca
6 60 F 6 112 0 2.43e+00 tccaca
6 71 C 6 168 0 2.43e+00 ataggc
6 78 C 6 106 0 2.43e+00 gtgttt

Refseq NC_000964.1
Legend Figure1 shows the Z-curves for the original sequence. Figure2 shows the Z-curves for the rotated sequence beginning and ending in dif site or the maximum of the GC disparity curve. Short vertical red line indicates the indicator gene (such as dnaA, dnaN, gidA, hemE etc) location, and short up vertical dark blue arrow indicates the identified oriC location, short down vertical brown arrow indicates dif site location. Purple peaks with the diamonds indicates the DnaA box clusters.
Figure 1
zcurve
Figure 2
zcurve

About
People
Publication
History
TUBIC
School of Science
Tianjin University, 300072
No. 92 Weijin Road
Nankai District, Tianjin
China
Tel: +86-22-27402697

Copyright © TUBIC, Tianjin University, Tianjin, China