RefSeq NC_002506.1
Accession number NC_002506.1
DoriC accession number ORI10030009
OriC length 1228 nt
OriC AT content 0.634365
The location of oriC region 1072221..1133 nt
Browse in NCBI
OriC map
OriC sequences
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
paraTTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-
parATTTCCGTTATTAGGGCTTTAAACAGATTGTACAGCATAGTTTATTTAAAACAACAAAAAGGTGAACATAAAACAATGAATCAAAATCACACATATTGGAGTATTAACAGAAAATTGATACCAAACGAACAAAGTTAAGTATAAAAACCGCGTTTAAATAACCCACATATTCTTCGATAAGGAGAAAACATTTTAAATATTACAGTGTCACTTATTTACAATGTAAAGCCACGTTTTGAAGTGATGATGAATAAATAAAAGCGAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGATGCGCAGGATTCAAGCAAGATGAGAAAATGCCTATCTTTCCTCCAGCGAATAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGATCATTCTTCCGTAAAAAATAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGCTATGAGTCGAGGCAAGAGAATTAACAATTGAAGATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCGCGGAAGCATGTAAATTCATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTTGGCTAGTCAGTGATGAAAAACCGTCTATCCTAACAAGTCTCAGTCAAAACAAGATAAACAGAACAACAGCCATGATCATGCTTTCGTAATCCCGCTCCGTCACCTTGGCCAGCGCAATATGGCGCTGAAGATGTCAATTGGAAGCACAAGTCACAAGTATTCATTGCGATATGGCCAAGAAATCATCCTCTCTTGATCATCTTTCCGTGGTCATGAGAGTACGAGAGGAAGGAGATACAACGACCTATCTTGATGTCATCCACTCAGGTTGTGGATAAACTGTGTGAGCACCTTGATCATGCTTAGAAGCTTACGTTGATCATTGATTCTGTTGACTGATGATCATGCTTAGAGGAACAAATGATCATGCTTTCGATCTTGTATTGATCATGGTTTCCATCGATACATGATCATGCTTCTGAATGGCTTAAAATAATCTCTTTTAATTACAATAAATTAGAACTAAAAATCGTCACAGATCATTAGATCACTCTAATCATATTTAATCATTTAAATCAGAAAGATCAGTTATTTAAAAACAACAAATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATCTAACC-

5'-DnaA box-3'      3'-DnaA box-5'     Spacer     DnaA-trio            ATP-DnaA box
AT-rich region     GATC   CtrA binding motif     Fis binding site     IHF binding site
The information of repeat sequences

Motif TGATCATGCTTYCG

StartP-valueSite
9634.04e-09GAGGAACAAATGATCATGCTTTCGATCTTGTATT
6744.04e-09ACAACAGCCATGATCATGCTTTCGTAATCCCGCT
10092.48e-08CATCGATACATGATCATGCTTCTGAATGGCTTAA
4142.48e-08AGCAGCAGCTTGATCATTCTTCCGTAAAAAATAG
9862.88e-08GATCTTGTATTGATCATGGTTTCCATCGATACAT

Motif CGGAACGATGATCAAGAGC

StartP-valueSite
3882.80e-11TAGGTATCACCGAAACGATGATCAAGAGCAGCAGCTTGA
5165.26e-11GATCTTCAATCGGATCGATGATCAAGAGGTAAATCGTCG
4459.50e-10TAGAGGGTTAAGGAAACATGATCAAGAGCTCATCATGGC
2721.96e-09GAGCCGTAAGCGGAACGATTAAACCGAGCCACTAAGTTA

Motif TTACGGTVRRTGYSAKDCDGA

StartP-valueSite
5711.44e-11CATTATCAATTTACGGTCGATGTCAGGCAGAGTAAGGCTTT
2981.90e-11AGCCACTAAGTTACGGTGAATGCCATTCTGATTGAAATGAT
12018.88e-11TATAGTGATATTACGGTAAGTGTGATACGGATCTAACC

Distribution of genes on leading or lagging strand
Distribution of nucleotide on leading or lagging strand
The result of BLAST Download

subject_id identity aln_length mismatches gaps q_start q_end s_start s_end e_value bit_score
ORI94040257 100.0 1228 0 0 1 1228 1228 1 0.0 2268
ORI95030459 99.349 1228 8 0 1 1228 7 1234 0.0 2224
ORI95030418 100.0 887 0 0 342 1228 1 887 0.0 1639
ORI96030546 100.0 887 0 0 342 1228 1 887 0.0 1639
ORI92730252 100.0 887 0 0 342 1228 1 887 0.0 1639
ORI10030009 100.0 887 0 0 342 1228 1 887 0.0 1639
ORI96030657 98.309 887 15 0 342 1228 1 887 0.0 1555
ORI95040354 76.28 371 64 22 868 1226 914 1272 1.12104e-44 176