Ori-Finder 2 Result - jobID: 2OeQ7045Jg (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Haloarcula hispanica ATCC 33960 chromosome I, complete sequence.
Chromosome size2995271 nt
Chromosome GC Level63.69%
The location of oriCs with ORB sequence2994338..0;
The location of DNA replication genes1..1575; 126862..127989; 1199761..1200936; 1600776..1601993; 1801058..1802386; 2714606..2715658;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 2994338..0
The size of oriC934 nt
The GC Level of oriC55.35%
DoriCORI10010185 ORI10010127
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common233252+32.00734.21e-11ACCCCTTTGTTTCAGGTGGA
Common505524-29.55341.66e-10ACCCCTCCGTTTCCGGTGGA
Common904923-18.39931.28e-08TCCCCTTCGTTTCGTGTGGA
The sequence of oriC
CCTATCCTCCCGCCGCCCGGAGTCGTCCGGTATGGCGGCTCTGCCCGTAAAAGATAGGCGAATTCACTTA
AGCCTACGTCAGACATTAGTCCTTTTTCTGACATGGGGAGGCATAGCACAGATCAGCGTGTGCGCGTTTC
CGCGGATGCAATCGGGACGGGAACTGTTCGGGTGGAGTCCGGTCATCCGAAACCCAGCGATTCGGATTAG
GGGTGGACCATCCTAGCCCCCCACCCCTTTGTTTCAGGTGGAACGACAGACATCCCTGGGGAGGGGGTGG
AGAATTACCGATCAAATCGGGAGCGGACCAGCTGTTCAAATCGGCGCGACTCGCCATACCGCTAGTTAGA
ACGGCCTAGACACTAGAAAACTGTATACTACCCTCTACTAGGGATTTGTTTTATCTAGTGCGGCTTTGGT
TTATGAGGTAGTGTATTAAACCTTTCCCCTTACTAGAGGACATTTTCGTCACCCTCACCCCCTCCCCCCG
GGCCTGTTTCCCGTTCCACCGGAAACGGAGGGGTGGGGGGGGTTGGCCCGTTACGGTCGCTTTGTCCTAC
AGGTCCCGTCCTGCCGTGGTACCACCACTCGTGTTCACACAGCGTACCAGCTCCCGGAACCACTCCATGG
CTCCCCTTCCCCTCCACTCATACCCCTGCCGTGCCATGCCCGTCTAACCCAGTGAAACTGAAGCTATAGT
CCTCTTTACGACAACGGAACCCATGCGGGAGCACTCATAAATATGCCAACATATATGTTTCATGGGTGGT
GTACCGAAATATTTAATATCGACTCACGGTACGGTTCATGTGGTTCAACTGGACGCACCGGAGAGCGCTG
ATGCTCACTAACGACGGTACTGACGCACTCCTCGCTCCCTCTGTTCCGGTGTCTCCAACTCTCTCCACAC
GAAACGAAGGGGACTCTCTCGACT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 934 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/2OeQ7045Jg/repfind.fasta
29 226 P 29 501 -3 8.40e-08 ccccccacccct[tc][tc]gtttc[ac]ggtggaacg
15  58 R 15  58  0 2.29e-04 cgaattcacttaagc
14 630 R 14 630  0 9.14e-04 ctccccttcccctc
13 330 R 13 330  0 3.66e-03 tcgccataccgct
18 561 R 18 561 -2 4.92e-03 ggt[cg]ccgtcctgcc[gc]tgg
15 240 P 15 501 -1 1.03e-02 gtttc[ac]ggtggaacg
12 267 P 12 475  0 1.46e-02 ggggagggggtg
12 747 P 12 747  0 1.46e-02 aacatatatgtt
19 233 P 19 903 -3 2.34e-02 cccctt[tc]gtttc[ag][gt]gtgga
19 504 F 19 903 -3 2.34e-02 tccac[ca][gc]gaaacg[ga]agggg
11 477 R 11 477  0 5.85e-02 ccccctccccc
16 104 R 16 906 -2 6.17e-02 gggga[ga]gca[ta]agcaca
16 263 P 16 475 -2 6.17e-02 cc[cg][tg]ggggagggggtg
16 520 R 16 520 -2 6.17e-02 gg[gt]tggggggggt[tg]gg
18 475 C 18 522 -3 7.87e-02 caccccc[tc]cc[ca][ca]ccgggc
13 103 R 13 511 -1 1.43e-01 tggggaggca[ta]ag
13 154 P 13 558 -1 1.43e-01 ggacggga[ac]ctgt
15 471 R 15 471 -2 2.16e-01 ccctc[ac]ccc[ca]ctccc
15 516 R 15 516 -2 2.16e-01 gg[ag]ggggtgggg[ga]gg
15 521 R 15 521 -2 2.16e-01 ggt[gt]ggggggg[tg]tgg
10   8 R 10   8  0 2.34e-01 cccgccgccc
10  27 C 10 332  0 2.34e-01 cggtatggcg
10  27 P 10 331  0 2.34e-01 cggtatggcg
10  39 R 10 665  0 2.34e-01 tctgcccgta
10 267 C 10 478  0 2.34e-01 ggggaggggg
10 575 P 10 575  0 2.34e-01 gtggtaccac
10 660 C 10 794  0 2.34e-01 gtgccatgcc
17  86 F 17 696 -3 2.62e-01 tagtcct[tc]ttt[ca][tc]gaca
17 220 R 17 478 -3 2.62e-01 tcc[tg][ag]gcccccc[at]cccc
12 225 R 12 478 -1 5.26e-01 gcccccc[at]cccc
12 227 C 12 272 -1 5.26e-01 cccccacc[ct]ctt
12 301 F 12 600 -1 5.26e-01 agcg[gt]accagct
12 511 F 12 910 -1 5.26e-01 gaaacg[ga]agggg
14  87 R 14  87 -2 7.49e-01 agtc[ct]tttt[tc]ctga
14 269 R 14 518 -2 7.49e-01 gg[ag]gggggtgg[ag]ga
14 468 F 14 474 -2 7.49e-01 tcaccc[tc]c[at]ccccc
14 477 R 14 628 -2 7.49e-01 cccc[ct]tcccc[ct]cgg
14 827 C 14 920 -2 7.49e-01 cc[gt]gagag[ca]gctga
16 246 P 16 494 -3 8.64e-01 ggtggaacg[ag][cg]a[ga]aca
16 266 R 16 517 -3 8.64e-01 tgggg[ag]ggg[gt]g[tg]ggag
16 267 C 16 632 -3 8.64e-01 gggga[ga]gggg[ta]gg[at]ga
16 472 C 16 516 -3 8.64e-01 cctc[ac]cc[ca]cc[tc]ccccc
16 517 C 16 630 -3 8.64e-01 gagggg[ta][ga]gggg[ga]ggt
9  27 R  9  27  0 9.36e-01 cggtatggc
9 125 R  9 125  0 9.36e-01 gcgtgtgcg
9 228 R  9 228  0 9.36e-01 ccccacccc
9 228 C  9 519  0 9.36e-01 ccccacccc
9 236 R  9 236  0 9.36e-01 ctttgtttc
9 267 R  9 267  0 9.36e-01 ggggagggg
9 291 F  9 315  0 9.36e-01 tcaaatcgg