Ori-Finder 2 Result - jobID: mWp38ZwXBs (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Haloarcula hispanica ATCC 33960 chromosome II, complete sequence.
Chromosome size488918 nt
Chromosome GC Level57.01%
The location of oriCs with ORB sequence29015..29327; 109422..110206; 152106..152392; 191488..191811; 383109..383351; 384540..385697; 488056..0;
The location of DNA replication genes1..1209; 108513..109421; 150759..152105; 383352..384539;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 29015..29327
The size of oriC313 nt
The GC Level of oriC59.11%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common127146+-5.581839.16e-06CACCCGTTGTGACCACTGGA
Common138157--7.254941.33e-05ACCACAGCGATTCCAGTGGT
Common187206--12.27433.9e-05ATCCCCTGTTTTCAGGAGTA
The sequence of oriC
TCTGACAGCAAGGGAACTCGCCCGTATTTTGTGAGCCTCCACCGGGTGAGAGGCGTTCCAGAGAAGGCCT
ATCAGCCATATCCGAACAGGCAGGCGATCCAGACCAGTACCAAGATGGATCTGTCACACCCGTTGTGACC
ACTGGAATCGCTGTGGTCGCTCCGTTCGTGTTACGACCACTCACTATACTCCTGAAAACAGGGGATCGCT
CCCGGTTGCTGCAGCTAGGAAACAGCGGCGGCGGCAGCGGTAGGGCACGTACCACCGCGTCCAGTAGCGT
CGGTTCGTGTCCTATCCGGCGTGTGTCACAGGG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 313 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
15 231 R 15 231 -2 2.43e-02 ac[ag]gcggcggcg[ga]ca
15 234 R 15 234 -2 2.43e-02 gcg[ga]cggcggc[ag]gcg
10 235 R 10 235  0 2.63e-02 cggcggcggc
17 122 P 17 122 -3 2.94e-02 gtcaca[ca]c[cg]g[tg]tgtgac
12  50 F 12  91 -1 5.91e-02 aggcg[ta]tccaga
14 147 R 14 147 -2 8.41e-02 tcgctg[tg][gt]gtcgct
14 236 R 14 236 -2 8.41e-02 ggcg[ga]cggc[ag]gcgg
16 227 R 16 234 -3 9.70e-02 gg[ac][ag]ac[ag]gcggcggcg
9   8 R  9   8  0 1.05e-01 caagggaac
11 160 F 11 279 -1 2.17e-01 tc[cg]gttcgtgt
11 234 F 11 237 -1 2.17e-01 gcggcggc[ga]gc
13 234 F 13 240 -2 2.88e-01 gcggc[ga]gcgg[ct]ag
13 250 P 13 281 -2 2.88e-01 tagg[ga]cacg[ta]acc
15  43 P 15  62 -3 3.15e-01 gg[gc]tga[gt]aggc[gc]ttc
8  65 R  8 291  0 4.20e-01 ggcctatc
8 163 F  8 282  0 4.20e-01 gttcgtgt
8 217 P  8 217  0 4.20e-01 gctgcagc
12   5 F 12 221 -2 9.76e-01 cagc[at]agg[ga]aac
12  39 P 12 123 -2 9.76e-01 ca[ca]cgggtg[at]ga
12  46 P 12  62 -2 9.76e-01 tga[gt]aggc[gc]ttc
12 120 P 12 299 -2 9.76e-01 ctgt[cg]acac[ca]cg
12 131 F 12 169 -2 9.76e-01 gtt[ga][tc]gaccact
12 201 P 12 201 -2 9.76e-01 ggga[tg]cg[ca]tccc
14   1 F 14 191 -3 1.01e+00 ctga[ca]a[ga]ca[ag]ggga
14  30 R 14  34 -3 1.01e+00 gtg[ag]gcc[ta]cc[at]ccg
9  38 F  9 261 -1 2.84e+00 ccaccg[gc]gt
9  39 P  9  39 -1 2.84e+00 cacc[gc]ggtg
9  42 P  9 123 -1 2.84e+00 cgggtg[at]ga
9  90 F  9 198 -1 2.84e+00 cagg[cg]gatc
9 119 F  9 301 -1 2.84e+00 t[cg]tgtcaca
9 143 F  9 201 -1 2.84e+00 gg[ag]atcgct
9 148 P  9 260 -1 2.84e+00 cgc[tg]gtggt
9 154 F  9 203 -1 2.84e+00 g[ga]tcgctcc
9 175 R  9 177 -1 2.84e+00 a[ct]cactcac
9 195 F  9 229 -1 2.84e+00 aaacag[gc]gg
9 288 R  9 290 -1 2.84e+00 g[tg]cctatcc
9 301 P  9 301 -1 2.84e+00 tgtg[ta]caca
13  11 F 13 201 -3 3.17e+00 ggga[at]c[tg]c[gt]cccg
13  15 R 13 170 -3 3.17e+00 actc[ga]cc[ca]g[tc]att
13  38 P 13 205 -3 3.17e+00 c[ca]accggg[ta]g[ac]ga
13 139 R 13 147 -3 3.17e+00 c[ag]ctgg[at][ag]tcgct
13 140 P 13 262 -3 3.17e+00 actgga[ac][tg]cg[cg]tg
13 212 F 13 235 -3 3.17e+00 cgg[tc][tg]gc[tg]gcagc
13 255 P 13 276 -3 3.17e+00 cacg[ta]acc[ag][ca]cgc
11   5 C 11 155 -2 3.25e+00 cagc[ag]agg[gc]aa
11  33 R 11  74 -2 3.25e+00 agcct[ca][ct]accg
11 155 C 11 221 -2 3.25e+00 gtcg[ca]tcc[gt]tt
11 197 R 11 223 -2 3.25e+00 aca[ga][ga]ggatcg
11 198 R 11 247 -2 3.25e+00 ca[gc]gggat[cg]gc
11 198 C 11 268 -2 3.25e+00 cagg[gt][gc]atcgc
OriC: 109422..110206
The size of oriC785 nt
The GC Level of oriC46.24%
DoriCORI10010177
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common175194+1.333671.77e-06CACCCCGTGTTGCCGCTGTA
Common476495-3.452941.03e-06CACCCCTCATTGCCGCTGTA
Common549568-4.45687.95e-07CACCCCTCGTTGCCGCTGTA
The sequence of oriC
ACCAACACAATCTCATGGACTTCATATTAATATTGTCCACCACCTTGCCGCTGTAAAACAGGTAAGATTG
GTATGCTATATTTGAAAAGTCGTATATCAGTCGCTCAGTTCCCATCTATTGGTGATATCCTACTCCAGGA
TACTGTGTGAATTTAGAAGGTAGTAGTACTCCCACACCCCGTGTTGCCGCTGTAACAGTTGAGATGAGTT
TCCAGATGAAAGCGGGCACAATAATGAGTGATAGCATACCTACACGCTATCTACACGCGCTTGAACAGAT
CCTGTGTAGAAGGGGTGAAAACCGGTATTTCACGCTACCGACGCTAAAGCGTCGTTATTTTAGTACGCTA
AAGCGTGGTACGGTACCAAACAGCATAGATCATAATAAAACTGATGATGCCTGTCCTAATTTAGTGGCTA
CGCGGAGTTATCAACTTGATATGGTAACACGCTGTGGCTGCTTTGCCGATTCACTTACAGCGGCAATGAG
GGGTGTACAAACATGACCTCGCATAAAAATAAGAGACAGGCAACTGTTCTCGATTGTTTACAGCGGCAAC
GAGGGGTGCGACTGCAGACTAGTCTAATACTAGCGTGTCATAGAGTACGTCACACACCCTCTCCTCCTTG
CGATCACCGCGGATGATTTCGCCGTCTGGAAAGTCTTCCAATCTGGTGCCACACTCTGTAAATTACCCCT
TATAACCCTGTTCATCGTATTTTGAGACGACCGCGTGAACCACGTTCTCAATCTTGACTGCGGCGTGGCC
ATTCAGAGTCGGAAG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 785 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
21 474 F 21 547 -1 2.48e-06 ttacagcggcaa[tc]gaggggtg
21 174 P 21 547 -2 7.45e-05 cacccc[gt][tc]gttgccgctgtaa
22 173 P 22 474 -3 4.10e-04 acacccc[gt][tc][ga]ttgccgctgtaa
13  44 P 13 546  0 2.58e-03 ttgccgctgtaaa
13 182 P 13 547  0 2.58e-03 gttgccgctgtaa
18  39 P 18 546 -2 3.47e-03 cc[at]c[cg]ttgccgctgtaaa
15 320 F 15 344 -1 7.26e-03 acgctaaagcgt[cg]gt
12  44 F 12 183  0 1.03e-02 ttgccgctgtaa
12  44 P 12 474  0 1.03e-02 ttgccgctgtaa
12 183 P 12 474  0 1.03e-02 ttgccgctgtaa
17  39 P 17 474 -2 1.23e-02 cc[at]c[ca]ttgccgctgtaa
19 315 P 19 318 -3 1.65e-02 ta[ca]cgacgct[at][at]agcgtcg
11 494 R 11 494  0 4.13e-02 gtacaaacatg
13 355 P 13 355 -1 1.01e-01 tggtac[gc]gtacca
13 428 P 13 428 -1 1.01e-01 tatcaa[cg]ttgata
10  23 P 10  23  0 1.65e-01 atattaatat
10  35 R 10  35  0 1.65e-01 tccaccacct
10  69 P 10 240  0 1.65e-01 ggtatgctat
10 575 P 10 575  0 1.65e-01 agactagtct
17  39 F 17 178 -3 1.85e-01 cc[ag][ct][cg]ttgccgctgtaa
12 138 R 12 591 -1 3.72e-01 gatactgtg[tc]ga
14 202 P 14 654 -2 5.29e-01 ga[ta]ga[gc]tttccaga
16 227 R 16 230 -3 6.10e-01 ac[ag]ata[ag]tgagt[ga]ata
9 168 R  9 612  0 6.61e-01 ctcccacac
9 170 R  9 170  0 6.61e-01 cccacaccc
9 377 R  9 584  0 6.61e-01 gatcataat
9 468 R  9 468  0 6.61e-01 attcactta
9 512 R  9 512  0 6.61e-01 ataaaaata
11 205 P 11 654 -1 1.36e+00 ga[gc]tttccaga
11 246 F 11 257 -1 1.36e+00 ta[ct]ctacacgc
13   4 C 13 595 -2 1.81e+00 aca[cg][at]atctcatg
13 379 R 13 379 -2 1.81e+00 tca[ta]aataa[at]act
13 565 R 13 724 -2 1.81e+00 gtgcg[ac]c[ta]gcaga
13 743 R 13 743 -2 1.81e+00 gttct[ca]a[ac]tcttg
15   4 P 15 133 -3 1.98e+00 acaca[ag]t[ca]tc[ac]tgga
15 158 P 15 158 -3 1.98e+00 gg[tg]agta[gc]tact[ca]cc
15 346 P 15 443 -3 1.98e+00 gc[tc]a[ac]agcgtg[gt]tac
15 578 P 15 578 -3 1.98e+00 ctagt[ca]t[at]a[tg]actag
15 651 R 15 654 -3 1.98e+00 cc[gt]tctg[ga]aa[ag]gtct
8   9 C  8 600  0 2.64e+00 atctcatg
8  82 R  8  82  0 2.64e+00 tgaaaagt
8 159 R  8 391  0 2.64e+00 gtagtagt
8 177 C  8 223  0 2.64e+00 cccgtgtt
8 193 P  8 530  0 2.64e+00 aacagttg
8 208 P  8 654  0 2.64e+00 tttccaga
8 249 F  8 260  0 2.64e+00 ctacacgc
8 251 P  8 590  0 2.64e+00 acacgcta
8 323 C  8 644  0 2.64e+00 ctaaagcg
8 347 C  8 644  0 2.64e+00 ctaaagcg
8 384 C  8 717  0 2.64e+00 ataaaact
OriC: 152106..152392
The size of oriC287 nt
The GC Level of oriC53.31%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common236255--14.50516.09e-05CCCCCCGTGTGCGAAGTGAA
The sequence of oriC
CACGAAGAGACGCCGACGGCGGCATCAAATTCGTTTCGCACACAGGGGAGTGGCCTCGGTGAGCGTATTA
TTAGAATGACTAAGTATGTCTGACAACAGTACGCAAGATTTCATTTCGCACACGGGGTGTCTCCTCTAGA
CTGATCAGTCAATTCAGCTCTCACACGGGGTCCACGCGGAAAGCGACCAAAATCATATCGCACACGGGGA
GCCCTACCTCGACTCCGTCGGCGAATTCACTTCGCACACGGGGGGTGTGATCCGACGAAATAACAACAGT
TGTCGTC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 287 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
24 106 F 24 232 -3 4.50e-06 ga[ta]ttca[tc]ttcgcacacgggg[tg]gt
21 109 F 21 235 -2 9.96e-06 ttca[tc]ttcgcacacgggg[tg]gt
17 110 F 17 192 -1 6.88e-05 tcat[ta]tcgcacacgggg
21  27 F 21 233 -3 1.89e-04 aattc[ga][tc]ttcgcacac[ag]gggg
16 114 F 16 240 -1 2.59e-04 ttcgcacacgggg[tg]gt
18  29 F 18 109 -2 4.64e-04 ttc[ga]tttcgcacac[ag]ggg
20 150 F 20 233 -3 6.49e-04 aattca[gc][ct]tc[tg]cacacgggg
20 189 F 20 233 -3 6.49e-04 aa[at]tca[tc][at]tcgcacacgggg
12 115 F 12 197  0 1.38e-03 tcgcacacgggg
12 138 P 12 138  0 1.38e-03 gactgatcagtc
12 197 F 12 241  0 1.38e-03 tcgcacacgggg
17 192 F 17 236 -2 1.65e-03 tca[tc][at]tcgcacacgggg
19 109 F 19 152 -3 2.20e-03 ttca[tg][tc]tc[gt]cacacggggt
14  33 F 14 113 -1 3.62e-03 tttcgcacac[ag]ggg
14  34 F 14 240 -1 3.62e-03 ttcgcacac[ag]gggg
16  47 R 16  47 -2 5.83e-03 gagtggc[ct][tc]cggtgag
18  25 F 18 187 -3 7.43e-03 caaa[ta]tc[ga]t[ta]tcgcacac
13 115 F 13 158 -1 1.35e-02 tc[gt]cacacggggt
10  90 R 10  90  0 2.21e-02 tgacaacagt
10 118 F 10 161  0 2.21e-02 cacacggggt
17  30 F 17 192 -3 2.48e-02 tc[ga]t[ta]tcgcacac[ag]ggg
17 153 F 17 192 -3 2.48e-02 tca[gt][ca]tc[tg]cacacgggg
12  35 F 12 197 -1 4.97e-02 tcgcacac[ag]ggg
12 158 F 12 197 -1 4.97e-02 tc[tg]cacacgggg
12 158 F 12 241 -1 4.97e-02 tc[tg]cacacgggg
9  10 P  9 224  0 8.84e-02 cgccgacgg
9  15 R  9  15  0 8.84e-02 acggcggca
9 161 F  9 200  0 8.84e-02 cacacgggg
9 161 F  9 244  0 8.84e-02 cacacgggg
11  10 P 11  10 -1 1.82e-01 cgccg[at]cggcg
11  90 R 11 269 -1 1.82e-01 tgacaaca[ga]ta
11 272 P 11 272 -1 1.82e-01 acaac[at]gttgt
13   8 F 13 220 -2 2.42e-01 gac[gt]ccg[at]cggcg
15   8 P 15  11 -3 2.65e-01 ga[ct]gccg[ac]cg[gt]cggc
15 230 P 15 230 -3 2.65e-01 gcgaa[tg]t[cg]a[ca]ttcgc
8  92 F  8 272  0 3.53e-01 acaacagt
8 129 R  8 129  0 3.53e-01 tctcctct
10  40 C 10 126 -1 6.63e-01 cacag[ga]ggag
12  35 F 12 158 -2 8.20e-01 tc[gt]cacac[ag]ggg
12 118 F 12 246 -2 8.20e-01 cac[ag][cg]ggggtgt
12 139 R 12 139 -2 8.20e-01 actga[tc][ct]agtca
14 114 P 14 221 -3 8.48e-01 ttcgc[ac][cg]acgg[ga]gt
14 138 C 14 140 -3 8.48e-01 gact[ga][ag]tcagt[ct]aa
9  12 F  9 224 -1 2.39e+00 ccg[at]cggcg
9  38 F  9 161 -1 2.39e+00 cacac[ag]ggg
9  86 P  9  86 -1 2.39e+00 tgtc[ta]gaca
9  90 C  9 275 -1 2.39e+00 tg[at]caacag
9  91 P  9 275 -1 2.39e+00 gacaac[at]gt
9 133 R  9 153 -1 2.39e+00 ctct[ac]gact
9 146 P  9 232 -1 2.39e+00 agt[cg]aattc
OriC: 191488..191811
The size of oriC324 nt
The GC Level of oriC59.26%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common119138+-11.82813.56e-05ACCCCCTGTTGTCAGGAGTA
Common168187+-7.254941.33e-05ACCACAGCGATTCCAGTGGT
Common179198--5.581839.16e-06CACCCGTTGTGACCACTGGA
The sequence of oriC
CCCTGTGACACACGCCGGATAGGACACGAACCGACACTGAACCAACGCTACTGGACGCGGTGGTACGTGC
CCTGCCGCCGTCGACGCCGCTGTTTGCTAGCTGCAGCAACCGGGAGCGACCCCCTGTTGTCAGGAGTATA
GTGAGGACTCGTAACACGAACGGAGCGACCACAGCGATTCCAGTGGTCACAACGGGTGTGACAGAACCAT
CTTGGTACTGGTCTGGGTCGCCTGCCTGTTCGGATATGGCTGATAGGCTTTCTCTGGACCGCCTCTCACC
CGACGGAGGCTCACAAAATACGGGCGAGTTTCCTTGCTGTCAGA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 324 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
11  71 R 11  71  0 7.04e-03 ctgccgccgtc
17 185 P 17 185 -3 3.16e-02 gtcaca[ac]c[gc]g[gt]tgtgac
14  75 P 14  75 -2 9.01e-02 cg[cg]cgtcgacg[cg]cg
14 163 R 14 163 -2 9.01e-02 agcgac[ca][ac]cagcga
9 112 F  9 161  0 1.13e-01 ggagcgacc
11  23 F 11 153 -1 2.32e-01 acacgaac[cg]ga
13  79 R 13  79 -2 3.09e-01 gtcg[ac]cgc[ca]gctg
8  99 P  8  99  0 4.51e-01 gctgcagc
8 123 R  8 123  0 4.51e-01 ctgttgtc
8 129 R  8 141  0 4.51e-01 tcaggagt
8 202 C  8 209  0 4.51e-01 agaaccat
8 238 R  8 252  0 4.51e-01 ttcggata
10  73 P 10 280 -1 8.45e-01 gcc[gt]ccgtcg
12   2 P 12 192 -2 1.05e+00 ctgt[gc]acac[ac]cg
12  20 P 12  61 -2 1.05e+00 agg[ag]cacg[at]acc
12  80 C 12  98 -2 1.05e+00 tcgacg[ct]cg[ct]tg
12  91 F 12 307 -2 1.05e+00 gttt[gc]ct[at]gctg
12 121 F 12 311 -2 1.05e+00 cc[ct]tg[tc]tgtcag
12 198 C 12 205 -2 1.05e+00 tg[ag][ct]agaaccat
12 221 F 12 262 -2 1.05e+00 tctgg[ga][tc]cgcct
14  59 P 14 143 -3 1.08e+00 gtg[gt]tacg[ta]g[ct]cct
14  66 C 14 276 -3 1.08e+00 gtg[cg][cg]ctgcc[gt]ccg
14  73 F 14  76 -3 1.08e+00 gccg[ct]cg[ta]cg[ac]cgc
9   3 F  9 196 -1 3.04e+00 tgtgaca[cg]a
9   3 P  9   3 -1 3.04e+00 tgtg[at]caca
9  14 R  9  16 -1 3.04e+00 c[ca]ggatagg
9  30 C  9 193 -1 3.04e+00 cc[gc]acactg
9  35 F  9 200 -1 3.04e+00 ac[ta]gaacca
9  55 P  9 167 -1 3.04e+00 cgc[gt]gtggt
9  71 C  9 281 -1 3.04e+00 ctgcc[gt]ccg
9  75 R  9  98 -1 3.04e+00 cg[ca]cgtcga
9 114 R  9 168 -1 3.04e+00 agcgac[ca]cc
9 124 F  9 314 -1 3.04e+00 tg[tc]tgtcag
9 192 P  9 273 -1 3.04e+00 cgggtg[ta]ga
13  48 F 13 215 -3 3.40e+00 tactgg[at]c[gt][cg]ggt
13  49 P 13 171 -3 3.40e+00 actgga[ca][gt]cg[gc]tg
13  76 R 13  99 -3 3.40e+00 gcc[ga][ta]cgacg[ct]cg
13 164 R 13 172 -3 3.40e+00 g[ct]gacc[at][ct]agcga
13 224 C 13 274 -3 3.40e+00 g[ga]gt[cg]g[cg]ctgcct
11   8 F 11 276 -2 3.48e+00 cac[ac]cg[ca]cgga
11  27 F 11  38 -2 3.48e+00 gaacc[ga]ac[ag]ct
11 158 C 11 308 -2 3.48e+00 aa[ca]gga[ga]cgac
11 212 R 11 217 -2 3.48e+00 tgg[tg][at]ctggtc
11 247 P 11 270 -2 3.48e+00 gg[cg]tga[tg]aggc
11 264 C 11 277 -2 3.48e+00 tgg[ag]c[ct]gcctc
12   2 C 12  85 -3 1.05e+01 c[tg]g[tc]gaca[ca]acg
12   3 P 12 193 -3 1.05e+01 t[gc]tg[at]cacac[gc]c
12   6 P 12 300 -3 1.05e+01 ga[ca]ac[at]cgcc[gc]g
12  11 F 12 245 -3 1.05e+01 a[ct]g[cg]c[gt]gatagg
12  20 F 12 143 -3 1.05e+01 aggac[at]cg[at]a[ca]c
OriC: 383109..383351
The size of oriC243 nt
The GC Level of oriC58.02%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common201220-0.1067262.41e-06ACCCCACTGGTTCCGCTGTT
The sequence of oriC
ACGCATCGTAAGCAGCGGTTCGATAAAACACGTCGGGACGATGCCGTTCAGCCTTGACTTCGGGACGCTC
CGCTCATCGTTGACGACAGTCAGAGCACGTCATCGGTATCGAACAGGCCCCGCATTCATTGGATCGCAAT
GGCTTGTCGCTCGCGGTCCGGAATTCCGTCGGAGAGATTGTCTATGTCTGCTCTCCGTCTAACAGCGGAA
CCAGTGGGGTGGCTAACAGCGGAAGCGGTGGGG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 243 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
21 198 F 21 222 -2 7.14e-06 ctaacagcggaa[cg]c[ag]gtgggg
10 158 P 10 158  0 1.58e-02 cggaattccg
17 140 R 17 144 -3 1.77e-02 ggc[tc]tg[tg]cgctcgc[gt]gt
11  29 F 11  56 -1 1.31e-01 ac[gt]tcgggacg
11 215 R 11 232 -1 1.31e-01 ggggtggc[tg]aa
13  81 C 13 187 -2 1.74e-01 gacga[cg]ag[tg]caga
13 103 C 13 135 -2 1.74e-01 cg[gt]ta[tc]cgaacag
13 208 R 13 213 -2 1.74e-01 aa[ct]c[ag]gtggggtg
15  43 F 15  69 -3 1.90e-01 ccg[tc]tca[gt]c[cg]ttgac
8  17 P  8 106  0 2.53e-01 gttcgata
8  32 F  8  59  0 2.53e-01 tcgggacg
8 174 C  8 197  0 2.53e-01 agattgtc
10 106 C 10 138 -1 4.75e-01 ta[tc]cgaacag
12  14 R 12 137 -2 5.88e-01 gc[gt]gttcg[ag]taa
9  17 R  9 137 -1 1.71e+00 gttcg[ag]taa
9  38 P  9  96 -1 1.71e+00 cgatg[ca]cgt
9 102 R  9 135 -1 1.71e+00 tcggta[ta]cg
9 141 C  9 222 -1 1.71e+00 g[ca]ttgtcgc
9 141 C  9 198 -1 1.71e+00 g[ca]ttgtcgc
9 164 P  9 164 -1 1.71e+00 tccg[ta]cgga
9 167 P  9 190 -1 1.71e+00 g[ta]cggagag
13  43 R 13  45 -3 1.91e+00 c[ca]gttc[ac]g[ca]cttg
13  73 F 13  99 -3 1.91e+00 tcatcg[tg]t[ga][at]cga
13 177 R 13 179 -3 1.91e+00 t[tc]gtct[ag]t[ga]tctg
11  28 C 11  45 -2 1.96e+00 ca[ca]gtcgg[ga]ac
11  47 F 11  73 -2 1.96e+00 tca[gt]c[cg]ttgac
11  55 P 11 155 -2 1.96e+00 ga[ca]ttc[gc]ggac
11  99 R 11 181 -2 1.96e+00 tc[ag]tc[gt]gtatc
12   3 F 12 202 -3 5.88e+00 ca[tg]cg[tg]aa[gc]cag
12   3 F 12 226 -3 5.88e+00 ca[tg]cg[tg]aagc[ag]g
12   6 F 12 205 -3 5.88e+00 cg[tg]aa[gc]cag[ct]gg
12   6 F 12 229 -3 5.88e+00 cg[tg]aagc[ag]g[ct]gg
12  30 F 12 166 -3 5.88e+00 cgtcgg[ga][ag][ca]gat
12  38 P 12  99 -3 5.88e+00 cgat[ga]ccg[ta]t[cg]a
12  54 P 12 116 -3 5.88e+00 tga[ca]t[tg]cggg[ag]c
12  64 R 12 112 -3 5.88e+00 acgc[tc]ccg[cg][ta]ca
12  68 F 12 186 -3 5.88e+00 tc[ct]gctc[at][tc]cgt
12  81 R 12 220 -3 5.88e+00 g[ag]cgaca[ga]tc[ag]g
12  81 R 12 196 -3 5.88e+00 g[ag]cgaca[ga]tc[at]g
12 104 F 12 217 -3 5.88e+00 ggt[ag][tg]c[gt]aacag
12 115 F 12 154 -3 5.88e+00 gg[ct]cc[cg]g[ca]attc
12 164 F 12 193 -3 5.88e+00 tccgtc[gt][ga]a[gc]ag
12 164 R 12 171 -3 5.88e+00 tc[ct]gt[ct][ga]gagag
8   1 F  8  72 -1 6.08e+00 c[gt]catcgt
8   1 P  8  37 -1 6.08e+00 [cg]gcatcgt
8   6 C  8 121 -1 6.08e+00 cgtaag[ct]a
8  10 F  8 200 -1 6.08e+00 a[ga]cagcgg
8  10 F  8 224 -1 6.08e+00 a[ga]cagcgg
8  11 F  8 231 -1 6.08e+00 g[ca]agcggt
8  12 R  8  79 -1 6.08e+00 cagc[ga]gtt
OriC: 384540..385697
The size of oriC1158 nt
The GC Level of oriC53.80%
DoriCORI10010179
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common8099+-8.035721.58e-05ACCCCGCCACTTCCGCTGTT
Common135154+-0.8971373.08e-06ACCCCACCGCTTCCGCTGTT
Common191210+-1.008683.16e-06ACCCCACTACTTCCGCTGTT
Common247266+-0.8971373.08e-06ACCCCACCGCTTCCGCTGTT
Common371390+0.1067262.41e-06ACCCCACTGGTTCCGCTGTT
Common553572-0.1067262.41e-06ACCCCACTGGTTCCGCTGTT
The sequence of oriC
TTGTGTGTAGTTGCAACACGGAGTGTCTTAACCTTTGGTTCCGCTGCTTCCGCTGTTCGGTTGGGTATAT
AAATGATTGACCCCGCCACTTCCGCTGTTAGATGAGAGGGGAACACCTGACTGACCACTCCCCCACCCCA
CCGCTTCCGCTGTTAGATGGGAAATGGGATAGCAATCCTCCTACTCCCCCACCCCACTACTTCCGCTGTT
AGATGAGAAATGGGATAGCGACCCTCCTACTCCCCCACCCCACCGCTTCCGCTGTTAGGGCGGTAGCCGA
GAAGTTCCCTGGTCGAGGAACGGGATCGAGTAACTGCGAGTGGTTAGACAGCGGGATTTCGCGGGATCAT
AGCTGTGGAGCGACACACCCACCCCACTGGTTCCGCTGTTAGGACCGAAAGTTGGTGGTGACCTATCCAG
ATCGCGGCCTGAATATCTCTAGAGCTAGTGAATAACTTCAAGTGCTTCGGCAAGAAACCAAAGCCGTATG
ACGTTATCACAAAATAGCAAAGCACCCCCTCCCATGGGGGTGGTGCCGTCTATTTATTCCCTAACAGCGG
AACCAGTGGGGTGGGGGTGTGGACCCACTCTTATTACAGTTGCTGGGGCAGGCCATCCACAACTTCCAGT
TGAGGCGGAGAGTCGACTGAGGCGTCTATCGACTCGACACAGCGGTGAACCATACGGCCCAAACTTACGC
CGACAGATGATACCCGGAGTAGACTTTATTCATGAGCGAGAGTAAAACAACCGCTCGGTAAGCGTACGGA
TTGACTGAATCCAGAACTGTAATATTACTTGAAGCTTCATTGTCCATTATGCCCGACAAAAAACCACAGC
CAAATAATCCATTAGCTCCGTATTATCCCTCAGAAACGCCGAGTTTGTCGGGGAATGGTCGAAAGTGGTT
TGCCACACTTGTTCTCGGGTTCTGGCTATTTCTGGCGGCGATTGCGCTCGCTGTTGAGCTTTTCCTGTAA
TTTCGCCACAGTTGCGACTGAGAACCGCCGGCACGAATAGACACACCCGGCAGCGCCCAATATCCATTTT
CAGCGTATTACCCGCGTCTCTTCACCTCACGGCCCCTCTCCAGTTTCGCTCGCACCAGACTGGGCTCCCG
ATCACTCACCGATAATCGCTGTGGAGCCGGCCTGCCCC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 1158 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
54  143 F 54  199 -3 7.78e-22
cttccgctgttagatg[ga]gaaatgggatagc[ag]a[tc]cctcctactcccccaccc
cac
47  126 F 47  182 -3 8.34e-18
actcccccaccccac[ct][ga]cttccgctgttagatg[ga]gaaatgggatagc
37  160 F 37  216 -2 1.20e-13
gaaatgggatagc[ag]a[tc]cctcctactcccccaccccac
30  126 F 30  238  0 3.27e-13 actcccccaccccaccgcttccgctgttag
36  176 F 36  232 -2 4.53e-13
cctcctactcccccaccccac[tc][ag]cttccgctgttag
31  362 P 31  549 -1 7.61e-12 acac[ac]cccaccccactggttccgctgttagg
26  367 P 26  549  0 8.37e-11 cccaccccactggttccgctgttagg
32  124 P 32  550 -3 2.74e-09
ccac[ta]cccccaccccac[ct]g[cg]ttccgctgttag
32  238 P 32  548 -3 2.74e-09
ac[ta]cccccaccccac[ct]g[cg]ttccgctgttaggg
29  241 P 29  548 -2 4.78e-09 cccccaccccac[ct]g[cg]ttccgctgttaggg
28   79 F 28  190 -2 1.78e-08 acccc[ga]c[ct]acttccgctgttagatgaga
30  182 P 30  550 -3 3.59e-08 ac[ta]cccccaccccact[ag][cg]ttccgctgttag
27  129 P 27  550 -2 6.61e-08 cccccaccccac[ct]g[cg]ttccgctgttag
27  185 P 27  550 -2 6.61e-08 cccccaccccact[ag][cg]ttccgctgttag
26  243 F 26  367 -2 2.45e-07 cccaccccac[ct]g[cg]ttccgctgttagg
20   87 F 20  198  0 3.43e-07 acttccgctgttagatgaga
28   79 F 28  134 -3 4.63e-07 acccc[ga]cc[ag]cttccgctgttagatg[ag]ga
25  131 F 25  367 -2 9.04e-07 cccaccccac[ct]g[cg]ttccgctgttag
25  187 F 25  367 -2 9.04e-07 cccaccccact[ag][cg]ttccgctgttag
22   79 F 22  246 -2 4.46e-05 acccc[ga]cc[ag]cttccgctgttag
22   85 F 22  140 -2 4.46e-05 cc[ag]cttccgctgttagatg[ag]ga
19   88 F 19  143 -1 7.82e-05 cttccgctgttagatg[ag]ga
14  256 P 14  548  0 1.40e-03 ttccgctgttaggg
16   85 F 16  252 -1 4.21e-03 cc[ag]cttccgctgttag
13   88 F 13  255  0 5.62e-03 cttccgctgttag
13  199 F 13  255  0 5.62e-03 cttccgctgttag
13  256 F 13  380  0 5.62e-03 ttccgctgttagg
20   40 F 20  249 -3 1.06e-02 cc[ga]c[tc]gcttccgctgtt[ca]gg
20   40 F 20  373 -3 1.06e-02 cc[ga]ctg[cg]ttccgctgtt[ca]gg
20   40 P 20  549 -3 1.06e-02 cc[ga]ctg[cg]ttccgctgtt[ca]gg
15   45 F 15  254 -1 1.58e-02 gcttccgctgtt[ca]gg
12   45 F 12  142  0 2.25e-02 gcttccgctgtt
12   89 F 12  380  0 2.25e-02 ttccgctgttag
12   89 P 12  550  0 2.25e-02 ttccgctgttag
12  144 F 12  380  0 2.25e-02 ttccgctgttag
12  144 P 12  550  0 2.25e-02 ttccgctgttag
12  200 F 12  380  0 2.25e-02 ttccgctgttag
12  200 P 12  550  0 2.25e-02 ttccgctgttag
17   40 F 17   82 -2 2.69e-02 ccgc[tc][ga]cttccgctgtt
17   40 F 17  137 -2 2.69e-02 cc[ga]c[tc]gcttccgctgtt
17   40 F 17  193 -2 2.69e-02 cc[ga]ct[ga]cttccgctgtt
17   43 F 17  376 -2 2.69e-02 ctg[cg]ttccgctgtt[ca]gg
17   43 P 17  549 -2 2.69e-02 ctg[cg]ttccgctgtt[ca]gg
17  344 F 17 1130 -2 2.69e-02 gat[ca]at[ac]gctgtggagc
14   43 F 14  196 -1 5.90e-02 ct[ga]cttccgctgtt
11   35 F 11  377  0 8.99e-02 tggttccgctg
11   35 P 11  554  0 8.99e-02 tggttccgctg
11   46 F 11  199  0 8.99e-02 cttccgctgtt
11   46 F 11   88  0 8.99e-02 cttccgctgtt
11  409 R 11  409  0 8.99e-02 gacctatccag
OriC: 488056..0
The size of oriC863 nt
The GC Level of oriC46.81%
DoriCORI10010180 ORI10010129
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common288307+-5.247218.49e-06ACCCCCCGGTTTTCACGAGA
Common647666+-12.94354.46e-05CCCCCCATATTTCATGAGAG
The sequence of oriC
CGTGTGGAGCCGCCGGCTGCGAGGGCTGCACAAAACGAACATTGTGGGCAATAGCTCAATCGCCTACATG
ATGTATTAGAACAAACAAGATGCCTGAGTTCGGTTAGATAAACAGATCTCTCATGTGGTACAGGGTGTGT
GACCTGAATAATTTCAGCTGCGATGTTATCTTTGATCTGTCTCTTTTCAGGAAAGTCTCCAGATGAGATT
TCCAACGCAAACACGCTACGCAGGCGGCGTAGTTCAACTTTGATAGTGTCTTGCTGTATCGGCCGTAGAG
AAGTGGGACCCCCCGGTTTTCACGAGAGTTAATATCGGCCAGTGAACCGGCATTTTGTTGCCCACCCCCC
ACATTTCACGAGAGTTTAAGAATAGCAGCTCCTAACTCATGAAATGTGGGGTGTAGTTGAGCAGAGCAAG
TCATCAATTGTGTAGTAACTCAGAGAAAGCACGGAGTCTAGACAGTGAGTGGAGAGGGATTGATGGTCTC
TCAGGGAATCAAATACAGAGCAGCGCGACCGTAGACTCCTATGGATATAACCTACTAGCGATGGATATTG
TTTGTTGACGACGATAACTGACCATGAGAAGTTGAGGTCTCCTTTCTGCCTTGCTGAATAGAAGAGACAG
GTAGATATCTCCCCCGCCCCCCATATTTCATGAGAGTTGCTATAGGGGAGGGAAGAAATAATGTCTGACG
CTTCTTGCTGAGTTTCCACTAGAGAATTAAACTGAACCTAACGTATTACGGATGCTGTTTTGACCCACTT
ATATTAAATCTTCTTCTCATTCAGAGTTTCATTTTGCCCTCTCTTCCCCTCCTCTCCAACGATACTCTCG
TGAAATCTGGGGGGCGGGGGTTG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 863 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/mWp38ZwXBs/repfind.fasta
27 640 P 27 833 -2 3.67e-08 cccccgcccccca[tg]atttca[tc]gagagt
25 340 P 25 833 -2 5.02e-07 ccc[ag]cccccca[cg]atttcacgagagt
21 344 P 21 833 -1 3.00e-06 cccccca[cg]atttcacgagagt
26 340 F 26 642 -3 3.27e-06 ccc[ag]cccccca[ct]atttca[ct]gagagtt
22 344 F 22 646 -2 2.48e-05 cccccca[ct]atttca[ct]gagagtt
21 288 P 21 833 -2 9.00e-05 cccccc[ga]g[ta]tttcacgagagt
23 287 F 23 343 -3 1.42e-04 acccccc[ga][gc][ta]tttcacgagagtt
15  76 R 15  76  0 1.95e-04 tagaacaaacaagat
20 807 R 20 807 -2 3.26e-04 cctctc[tc]tcccct[ct]ctctcc
19 343 P 19 385 -2 1.17e-03 ac[ca]ccccacatttca[ct]gag
16 346 P 16 385 -1 2.34e-03 ccccacatttca[ct]gag
16 385 P 16 648 -1 2.34e-03 ctcatgaaat[ga]tgggg
13 297 F 13 353  0 3.12e-03 tttcacgagagtt
13 352 P 13 833  0 3.12e-03 atttcacgagagt
12 297 P 12 833  0 1.25e-02 tttcacgagagt
12 393 R 12 393  0 1.25e-02 atgtggggtgta
14 352 F 14 654 -1 3.28e-02 atttca[ct]gagagtt
11 640 R 11 640  0 4.99e-02 cccccgccccc
11 640 C 11 849  0 4.99e-02 cccccgccccc
11 849 R 11 849  0 4.99e-02 gggggcggggg
16 385 F 16 836 -2 5.27e-02 ctc[ag]tgaaat[gc]tgggg
16 635 R 16 640 -2 5.27e-02 tat[ca][tc]cccccgccccc
18 297 F 18 655 -3 6.72e-02 tttca[ct]gagagtt[ag][ac]tat
13 654 P 13 833 -1 1.22e-01 atttca[tc]gagagt
15 123 R 15 123 -2 1.84e-01 tgtgg[tg]aca[gt]ggtgt
10 342 R 10 342  0 2.00e-01 caccccccac
17 225 P 17 225 -3 2.24e-01 ctacgc[ac]g[gc]c[gt]gcgtag
17 361 R 17 579 -3 2.24e-01 gagtt[tg]aaga[ag]ta[gc]cag
12  76 C 12 554 -1 4.49e-01 ta[gt]aacaaacaa
12  79 P 12 554 -1 4.49e-01 aacaaacaa[gt]at
12 389 F 12 840 -1 4.49e-01 tgaaat[gc]tgggg
14 629 P 14 629 -2 6.39e-01 gg[tg]agatatct[ca]cc
14 847 R 14 847 -2 6.39e-01 tggggg[gc][cg]gggggt
16 127 R 16 130 -3 7.37e-01 gt[ac]cag[gt]gtgtg[tg]gac
16 635 C 16 844 -3 7.37e-01 ta[tg][ca][tc]cccccgccccc
9  79 C  9 557  0 7.99e-01 aacaaacaa
9 176 P  9 621  0 7.99e-01 ctgtctctt
9 286 C  9 846  0 7.99e-01 gaccccccg
9 370 R  9 568  0 7.99e-01 aatagcagc
9 510 R  9 510  0 7.99e-01 cagcgcgac
9 557 R  9 557  0 7.99e-01 ttgtttgtt
9 778 R  9 778  0 7.99e-01 tcttcttct
11   7 P 11   7 -1 1.65e+00 agccg[cg]cggct
11  10 P 11 228 -1 1.65e+00 cgccg[gc]ctgcg
11  64 P 11  64 -1 1.65e+00 tacat[gc]atgta
11  67 R 11 426 -1 1.65e+00 atgatgt[ag]tta
11  83 P 11 328 -1 1.65e+00 aacaa[ga]atgcc
11 112 C 11 455 -1 1.65e+00 cagatct[cg]tca
11 173 C 11 457 -1 1.65e+00 gatctgtc[ta]ct
11 304 P 11 770 -1 1.65e+00 aga[gt]ttaatat