Ori-Finder 2 Result - jobID: If0plYmDEV (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Haloferax volcanii DS2 chromosome, complete genome.
Chromosome size2847757 nt
Chromosome GC Level66.64%
The location of oriCs with ORB sequence11529..11896; 570430..571176; 1593326..1594706; 1887008..1888353; 1889584..1890203; 2846902..257;
The location of DNA replication genes258..1952; 1403626..1404828; 1998477..1999643; 2160851..2161873; 2162076..2162873;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 11529..11896
The size of oriC368 nt
The GC Level of oriC56.25%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common242261+1.779831.58e-06CCCCCCTGATCTCCAGTTGA
Common253272-34.46125.16e-12ACCCCTTCGTTTCAACTGGA
Common289308+-11.93963.64e-05AGGGGTTTGTTTCGAGTGGA
The sequence of oriC
ACACGACAGTGGATAGAATAGGGGGAAATAGTTGGCGGTTTATGCACGTCCGTCCGTCACCGTGCGACGA
AATCCCACGGCGGAATCGACACGCAACGTTTACAAATACCCGCGAAGTACGAACTGATGCGAAGTCCCAT
GGGGTAGTGGCCAATCCTGTTGCCTTCTGGGGGCAACGACCCAGGTTCGAATCCTGGTGGGACTATTTCT
CCGATTCTCACGCGCTTCGAGGCTACGCTGTCCCCCCTGATCTCCAGTTGAAACGAAGGGGTGGGATTCG
AAAACCCAAGGGGTTTGTTTCGAGTGGAGTTCTTGAGTACGGATTCGCGGGACCACCGGATACGGCCGAT
ACGGGCCGCGAAAACCGC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 368 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
11 306 R 11 306  0 9.08e-03 gagttcttgag
15  28 R 15  28 -2 3.35e-02 ta[gt]ttggcggtt[tg]at
10 239 R 10 239  0 3.63e-02 gtcccccctg
16 129 F 16 278 -3 1.34e-01 cgaa[ga][ta]ccca[ta]ggggt
16 248 P 16 296 -3 1.34e-01 ga[ta]ctcca[gc]t[tc]gaaac
16 251 P 16 293 -3 1.34e-01 ctcca[gc]t[tc]gaaac[ga]aa
16 265 F 16 287 -3 1.34e-01 aaggggt[gt][gt]g[at]ttcga
9 185 P  9 273  0 1.45e-01 ttcgaatcc
11  21 P 11 201 -1 3.00e-01 gg[ga]gaaatagt
13  67 F 13 278 -2 3.98e-01 cgaaa[ta]ccca[ca]gg
13  67 F 13 129 -2 3.98e-01 cgaa[ag]tccca[ct]gg
13 123 R 13 123 -2 3.98e-01 ctga[ta]gcg[at]agtc
15 281 P 15 281 -3 4.36e-01 aaaccc[ac][at][gt]gggttt
8  24 P  8 201  0 5.81e-01 gaaatagt
8  46 F  8  50  0 5.81e-01 cgtccgtc
8  70 P  8 270  0 5.81e-01 aatcccac
8 108 P  8 323  0 5.81e-01 cccgcgaa
8 135 P  8 135  0 5.81e-01 cccatggg
8 138 R  8 138  0 5.81e-01 atggggta
8 192 C  8 329  0 5.81e-01 cctggtgg
8 278 F  8 358  0 5.81e-01 cgaaaacc
10 120 C 10 311 -1 1.09e+00 gaact[gc]atgc
10 135 F 10 284 -1 1.09e+00 ccca[ta]ggggt
10 152 F 10 189 -1 1.09e+00 aatcctg[tg]tg
10 195 C 10 241 -1 1.09e+00 gg[tg]gggacta
12  10 R 12  10 -2 1.35e+00 ggata[ga][ag]atagg
12  19 C 12 240 -2 1.35e+00 aggggg[ag]a[ac]tag
12  33 C 12 109 -2 1.35e+00 ggcg[gc]tt[tc]atgc
12 260 F 12 282 -2 1.35e+00 aa[ac]c[gc]aaggggt
12 356 R 12 356 -2 1.35e+00 cgc[gc]aaaa[cg]cgc
14 125 F 14 274 -3 1.39e+00 gat[gt]cgaa[ga][ta]ccca
14 272 F 14 352 -3 1.39e+00 ggg[ac][tc][tg]cgaaaacc
9   3 C  9 236 -1 3.92e+00 cgacag[tg]gg
9  17 R  9  19 -1 3.92e+00 a[ta]aggggga
9  53 C  9 142 -1 3.92e+00 cc[ga]tcaccg
9 111 F  9 128 -1 3.92e+00 gcgaagt[ac]c
9 123 C  9 230 -1 3.92e+00 c[tc]gatgcga
9 146 C  9 333 -1 3.92e+00 gtggcc[at]at
9 195 F  9 269 -1 3.92e+00 ggtggga[ct]t
9 208 C  9 228 -1 3.92e+00 ctccgat[tg]c
9 291 R  9 293 -1 3.92e+00 g[gc]tttgttt
9 336 F  9 345 -1 3.92e+00 c[gc]gatacgg
13  14 P 13 205 -3 4.38e+00 agaat[ac]gg[ga]g[ga]aa
13  14 P 13 240 -3 4.38e+00 aga[at][tc]aggggg[ag]a
13  32 C 13 331 -3 4.38e+00 tgg[ct]gg[tc][tc]tatgc
13  90 R 13 254 -3 4.38e+00 a[ca]gcaa[ca]gtt[tg]ac
13  97 P 13 272 -3 4.38e+00 gttt[at]c[ag]aat[ac]cc
13 176 P 13 176 -3 4.38e+00 cga[ca]cc[at]gg[tg]tcg
13 178 P 13 185 -3 4.38e+00 acc[ca][ag]g[ga]ttcgaa
13 223 C 13 227 -3 4.38e+00 gct[tc]cga[gt]gc[tg]ac
OriC: 570430..571176
The size of oriC747 nt
The GC Level of oriC59.57%
DoriCORI10010163 ORI10010213
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common3453+-9.597292.22e-05AAACCCCGATTTCATCTGAT
Common93112+-15.06286.8e-05ACCGCGTGTTCTCGTCTGGA
Common202221+-12.05123.73e-05ACACCATGTTTGCAAGTGAA
Common473492--11.27043.17e-05ACACCACCGTTGCACGTGAA
Common529548--14.17045.7e-05ACACCACGTTTGCAAGTGAA
The sequence of oriC
TAGCGTCGGTCCGTTGTAGCGTCCCCTTATTTAAAACCCCGATTTCATCTGATTCATGTGAATTGTGACG
ACGACGGTGTCGCCGGAGTCAGACCGCGTGTTCTCGTCTGGAACCGCCGTCTCTCGGTTGATGCTTGCTC
ACCCTATACTGTCCCATGTTATTGTATTTCGTGGGTCATGTGAACTCGTTTGAACAGACACACACCATGT
TTGCAAGTGAAAGAGAGTACGCGAGAGTAGCTAGTAGAACAACAGAGCATGTGTTCAACTAAAGCGTTGA
CATATTTCGGTGCTCACGGTGTACGTCTCGGTGGGATGCGTCTCCCGTTAACGAGGCGTAGACGGCCTCA
ATCGGAGTGAATCACCTGCAATGGTGGTGGGTGACGCGCGACGAGTCCCGTTCGAGGTTCACTTGCACCG
GTGCTCTCCCCGCGCAGTCGCCGGTCCCACCCCCTCCGCGGCGTCACCGCGCTTCACGTGCAACGGTGGT
GTCTGTGGGTACGCCGCGACCCATCGCTTCCCCGCCAATTCACTTGCAAACGTGGTGTGTGGGTGTCGGA
CCGCGGCTTTCGCGTTCCGCCGCGGCGACCCATTCACTTGTACGGCCGGTCTGTCCAGCCGCGTCGTCTG
TGACCCTTCGGCACCACCGACACGGCGCGACCGACGCTCCGCTCGACTCGACTGGTCGACGGGGTGACAG
TCGTCCCGCCGGCGACGGCCCCGCCCCTCGAAATGTCTTTACCTCGG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 747 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
23 198 P 23 528 -1 1.54e-07 cacacacca[tc]gtttgcaagtgaa
28 193 P 28 528 -3 1.93e-07 aca[gc][ac]cacacacca[tc]gtttgcaagtgaa
13 208 P 13 528  0 2.34e-03 gtttgcaagtgaa
18 361 F 18 473 -2 3.14e-03 tcac[cg]tgcaa[tc]ggtggtg
20 472 F 20 528 -3 4.39e-03 ttcac[gt]tgcaa[ca][gc]gtggtgt
11 155 R 11 155  0 3.74e-02 atgttattgta
11 487 R 11 487  0 3.74e-02 ggtgtctgtgg
16 407 F 16 472 -2 3.95e-02 ttcac[tg]tgca[ca]cggtg
18 361 F 18 529 -3 5.03e-02 tcac[ct]tgcaa[ta][gc]gtggtg
13 366 F 13 478 -1 9.12e-02 tgcaa[tc]ggtggtg
13 501 F 13 580 -1 9.12e-02 cgc[cg]gcgacccat
15 665 R 15 665 -2 1.38e-01 gctc[ca]gctcg[ac]ctcg
10   1 P 10 658  0 1.50e-01 agcgtcggtc
10 211 P 10 407  0 1.50e-01 tgcaagtgaa
10 407 F 10 528  0 1.50e-01 ttcacttgca
10 414 P 10 414  0 1.50e-01 gcaccggtgc
10 577 P 10 577  0 1.50e-01 cgccgcggcg
17 366 F 17 534 -3 1.68e-01 tgcaa[ta][gc]gtggtg[gt]gtg
17 478 F 17 534 -3 1.68e-01 tgcaa[ca][gc]gtggtgt[cg]tg
12 485 C 12 641 -1 3.37e-01 gtggtg[tg]ctgtg
12 524 F 12 588 -1 3.37e-01 cc[ac]attcacttg
14  84 F 14 551 -2 4.79e-01 gg[at]gtc[ag]gaccgcg
14 375 C 14 446 -2 4.79e-01 ggtggg[tg]ga[cg]gcgc
14 664 F 14 669 -2 4.79e-01 cgctc[cg][ga]ctcgact
16 506 R 16 509 -3 5.52e-01 cg[ac]ccc[at]tcgct[ta]ccc
9  53 F  9 175  0 5.99e-01 tcatgtgaa
9 406 R  9 406  0 5.99e-01 gttcacttg
9 505 F  9 584  0 5.99e-01 gcgacccat
9 527 F  9 591  0 5.99e-01 attcacttg
9 534 R  9 534  0 5.99e-01 tgcaaacgt
9 543 R  9 543  0 5.99e-01 ggtgtgtgg
9 547 R  9 547  0 5.99e-01 tgtgggtgt
9 718 R  9 718  0 5.99e-01 ccccgcccc
11  54 P 11 525 -1 1.23e+00 ca[ta]gtgaattg
11  74 P 11 458 -1 1.23e+00 cggtg[ta]cgccg
11  81 C 11 342 -1 1.23e+00 gccggagt[ct]ag
11  87 F 11 554 -1 1.23e+00 gtc[ag]gaccgcg
11 193 C 11 489 -1 1.23e+00 acagacac[ac]ca
11 210 P 11 472 -1 1.23e+00 ttgca[ac]gtgaa
11 303 P 11 643 -1 1.23e+00 cgt[cg]tcggtgg
11 407 F 11 592 -1 1.23e+00 ttcacttg[ct]ac
11 433 P 11 708 -1 1.23e+00 gc[ac]gtcgccgg
11 452 F 11 576 -1 1.23e+00 cc[tg]ccgcggcg
11 500 F 11 651 -1 1.23e+00 acg[cg]cgcgacc
13  49 F 13 171 -2 1.64e+00 tg[ag][tg]tcatgtgaa
13 441 P 13 550 -2 1.64e+00 cggtcc[cg]ac[ca]ccc
13 504 R 13 504 -2 1.64e+00 cgc[gt]accca[tg]cgc
13 638 F 13 652 -2 1.64e+00 cggc[ag]c[cg]accgac
15  12 R 15 361 -3 1.80e+00 gt[tg]gta[ga]cgtcc[ca]ct
15  41 P 15 357 -3 1.80e+00 att[tg]ca[tg][cg]tgattca
OriC: 1593326..1594706
The size of oriC1381 nt
The GC Level of oriC57.49%
DoriCORI10010164 ORI10010214 ORI10010170
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common123142+-7.70111.46e-05CACACCACGTTTCCGGTGAA
Common257276+-8.035721.58e-05CACACCTCGCTTCCGGTGAA
Common303322+-14.72816.36e-05GACACCACGTTTCCGGTGAA
Common470489+-7.366481.36e-05GACACCGTGTTTCCGGTGAA
Common570589+-7.70111.46e-05CACACCACGTTTCCGGTGAA
Common696715+-1.231763.33e-06CACACCGCGTTTCCGGTGAA
Common12411260+-0.3394362.69e-06CACACCGTGTTTCCGGTGAA
Common12641283+4.902967.08e-07ATACCTCCGTTTCGTGTGGA
Common13071326--7.70111.46e-05CACACCACGTTTCCGGTGAA
Common13541373--7.70111.46e-05CACACCACGTTTCCGGTGAA
The sequence of oriC
ACGTTACCGATTCGTCCCCCTGGGTAATTGCATTGACGCCACGGGAACGACACAGTCCGTCGGGGGAGAA
CGTTTCGAGGCTCGTTCCGGGAGGCTACGCACGGATGCACGAGAGTCGCATGCACACCACGTTTCCGGTG
AACGAGTGAGAGCTAAGTTCGGTCCGAGACCGGTGTAGACGTCGGTGTCGGCAGGTGACGGCTCGGCCGG
GTCCGGTCGGTCGTCGACGACTCACCACATCGTGTTCGCGACACCCCACACCTCGCTTCCGGTGAATCCC
GAGACCGGGTGAGACGGGTAGAGACACCACGTTTCCGGTGAATGAGGGGAAGATAGAGAACCGGAAAACC
CGGTCACAGAGCCGGGATACCACGAGCCGTCAGGACGGAAAGCGACAGTCGGTCGCTCACCGGTCAGCTC
TCCGTCGCCAACTTCGTCCGGCTCGGCGGAGAACGTAGCAACGCTGACAGACACCGTGTTTCCGGTGAAA
TACGATACAGGGCAGACGAGTCCCGCGGGGGTCGGAAAGCGGTCAAACAGCCGATGAGTCACGAGAGCGA
GGTCACGCGCACACCACGTTTCCGGTGAACCGAACCACGCGCCTGGCAGCGGCAAACGCATGGAAACACG
GGTGTGCGCGTTCGTATCTTTCCCCTCATTTTCGGGGGCACCCGAATCGAACCACTTATATTGAACACAC
CGCGTTTCCGGTGAAAACACCTGCAATAAGAGTTCTATCTGGGGAATAGGGACACTACGGGAGACCGAGA
TGAGACACCACATTTCCGGTGAGTCAGCCAGGCGAGTCCATCAGGCGCGGTCCAACACTCACTCGACTCG
CGTCGGGGTTCCTGTGTAGTTCAAGTAGCAATAATTAAATAGTATATTCGTGTTAACGACCATTGATACA
CTCGTGAAGTAAAGAAATACTCGTAACTCGAGTACGGTTCGAATCGAACCGTTCGTCTTAGACGTGTGTT
TTTCGGAGTTTGCGAGTCAGCACAGTCCGTGATTTCGGTCCGTTCTGGAGGGTCCTACGAGGTTTCGCGA
ACTCCCGTGAATCTGAGCGATTCGTGGCGAGACGGAACTTCACAGTCGACTCTCGTCACAGACCGCTTCC
AGCAACAGCGCACACACGGCATCGGTGCCGACGTAACTCGTCAGCTTCGTGCGCGTTCTCCGTCCTCAGG
TGGGACGCGAAGTGAGAGTAGCCGGCCTCGTGGGGTCAGGTAGACTCCCCCACACCGTGTTTCCGGTGAA
TCAATACCTCCGTTTCGTGTGGACGGAAAACCGGGGTTCGTGGGCGTTCACCGGAAACGTGGTGTGTGTG
TGCTGAGTCGAATGGTAAGTCCTTTCACCGGAAACGTGGTGTGTTGCGAAC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 1381 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
22  121 F 22  568  0 3.05e-08 gcacaccacgtttccggtgaac
22  122 P 22 1304  0 3.05e-08 cacaccacgtttccggtgaacg
27  563 P 27 1305 -2 9.41e-08 cac[ga]c[ga]cacaccacgtttccggtgaac
21  569 P 21 1305  0 1.22e-07 cacaccacgtttccggtgaac
21 1306 F 21 1353  0 1.22e-07 ttcaccggaaacgtggtgtgt
29  114 F 29  561 -3 1.84e-07 gtc[ga]c[ag][tc]gcacaccacgtttccggtgaac
26  118 P 26 1304 -2 3.48e-07 ca[tc][ga]cacaccacgtttccggtgaacg
20  122 P 20 1353  0 4.88e-07 cacaccacgtttccggtgaa
20  569 P 20 1353  0 4.88e-07 cacaccacgtttccggtgaa
23  123 F 23  303 -1 5.26e-07 acaccacgtttccggtgaa[ct]gag
23  693 P 23 1352 -1 5.26e-07 aacacacc[ga]cgtttccggtgaaa
19  303 F 19  570  0 1.95e-06 acaccacgtttccggtgaa
19  303 P 19 1353  0 1.95e-06 acaccacgtttccggtgaa
19  303 P 19 1306  0 1.95e-06 acaccacgtttccggtgaa
19  470 F 19 1241  0 1.95e-06 acaccgtgtttccggtgaa
21  300 F 21  771 -1 7.68e-06 gagacaccac[ga]tttccggtga
21  694 P 21 1306 -1 7.68e-06 acacacc[ga]cgtttccggtgaa
20  122 F 20  695 -1 2.93e-05 cacacc[ag]cgtttccggtgaa
20  470 F 20  696 -1 2.93e-05 acaccg[tc]gtttccggtgaaa
20  569 F 20  695 -1 2.93e-05 cacacc[ag]cgtttccggtgaa
20  695 F 20 1240 -1 2.93e-05 cacaccg[ct]gtttccggtgaa
25  253 F 25 1237 -3 2.96e-05 ccccacacc[tg][ct]g[ct]ttccggtgaatc
19  303 F 19  696 -1 1.11e-04 acacc[ag]cgtttccggtgaa
19  943 P 19  943 -1 1.11e-04 acggttcga[at]tcgaaccgt
21  301 F 21  468 -2 2.31e-04 agacacc[ag][ct]gtttccggtgaa
23  466 P 23 1306 -3 3.64e-04 aca[gc]acacc[ga][tc]gtttccggtgaa
18  123 F 18  774 -1 4.21e-04 acaccac[ga]tttccggtga
18  570 F 18  774 -1 4.21e-04 acaccac[ga]tttccggtga
18  774 P 18 1354 -1 4.21e-04 acaccac[ag]tttccggtga
18  774 P 18 1307 -1 4.21e-04 acaccac[ag]tttccggtga
20  122 F 20 1240 -2 8.34e-04 cacacc[ag][ct]gtttccggtgaa
20  122 F 20  256 -2 8.34e-04 cacacc[at]cg[tc]ttccggtgaa
20  256 F 20  695 -2 8.34e-04 cacacc[tg]cg[ct]ttccggtgaa
20  256 F 20  569 -2 8.34e-04 cacacc[ta]cg[ct]ttccggtgaa
20  256 P 20 1353 -2 8.34e-04 cacacc[ta]cg[ct]ttccggtgaa
20  256 P 20 1306 -2 8.34e-04 cacacc[ta]cg[ct]ttccggtgaa
20  257 F 20  303 -2 8.34e-04 acacc[ta]cg[ct]ttccggtgaat
20  303 F 20 1241 -2 8.34e-04 acacc[ag][ct]gtttccggtgaat
20  470 P 20 1352 -2 8.34e-04 acacc[ga][tc]gtttccggtgaaa
20  569 F 20 1240 -2 8.34e-04 cacacc[ag][ct]gtttccggtgaa
20 1240 P 20 1353 -2 8.34e-04 cacacc[ga][tc]gtttccggtgaa
20 1240 P 20 1306 -2 8.34e-04 cacacc[ga][tc]gtttccggtgaa
14  702 P 14 1352  0 2.00e-03 cgtttccggtgaaa
19  123 F 19  470 -2 3.00e-03 acacc[ag][ct]gtttccggtgaa
19  470 F 19  570 -2 3.00e-03 acacc[ga][tc]gtttccggtgaa
19  470 P 19 1306 -2 3.00e-03 acacc[ga][tc]gtttccggtgaa
13  129 F 13  702  0 7.99e-03 cgtttccggtgaa
13  309 F 13  702  0 7.99e-03 cgtttccggtgaa
13  310 F 13 1248  0 7.99e-03 gtttccggtgaat
13  477 F 13  703  0 7.99e-03 gtttccggtgaaa
OriC: 1887008..1888353
The size of oriC1346 nt
The GC Level of oriC54.16%
DoriCORI10010165
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common795814--9.039581.97e-05CCCCCACGACTTCATCTGTT
Common912931+-4.466437.1e-06CCCCCATCGCTTCATGTGTT
Common10411060--7.589561.43e-05CCCCCACCACTTCATGTGTT
Common11271146+-2.570244.57e-06ACCCCACCACTTCATCTGTT
Common12501269--8.370341.7e-05ACCCCGTGGCTTCATCTGTT
The sequence of oriC
ACTCCCGAAGGTGTGAGGGCGGTCGGTGGCTCACGAACGACCTCCTCCGTCGGTCTGCCGCCTCCACCGA
GTGATACGAACGAACTGCTCCATCGTTCCCGCAGCCAGAGCACCGACGACCGAGCGAATCCGCTGTTCGA
CGGCGACGACTCGAATCCGGTCGCGCTCGACGACGCGGTCACACCGATGCGACGGACACAATCACTAACT
CAATTGACGTTGGATACTGTTAGCTGTGTTCCCAATCTCACACCTGTGGTCCGGCGTGTCCCTCCAAACA
CCCCCCTTTCCCGTCGGCGTGCGCGAAACGCACGTGACCGGGCTCGTGGTGCTCATCGGACTCATCTTCG
GCGGGATGTATCTGTACACTCGCTGGCGTCAGTATCTTCGGTAGACACAGCGACGGACCGCGTTGCACCC
TCCCGACGAACAATACCACCGTCGAACTGACGGCCGAGTCAGAGAGTACAGTTCGTACGCTCTCCTCTCT
GCTGCCTCGCGCTTTCAACGACGAACGAACGCAGGCGAACTGTACTCTCTCCCGTCCCGCTTCGGCCATC
GCGTTCCACGTTAGAGAGTACATTTCGTATGCTTTCCTCAATATGAAGCGTTCTACGAGGGGGTGGGTGT
GGAGTTTTGAATGTATCGCGTTGTACAGGTCACCGCAGATGCGATGACGACATGACGGTTCCTCGGGGAG
TACCGTTTCGAGTGTATCTGATCTCGTGTCCTTCGCATCGGCCTCGGAGTCTCTGTTTCCGATTTCGTGT
GTACCACTTCCTGAGACGCATCTAAACAGATGAAGTCGTGGGGGTCAGATTTTCGTCCCGGATTCTCAGA
ACGATTTCTTTGCAGTCTATTTCCTTCGTCTCCGGTATACGAACTGGTTCAGTTTACAGTTTGGTTGTCA
CCCCCCATCGCTTCATGTGTTCTTGTGGTTCGTCTCTATCCACAGCAGCGCTGCACTACCACCGGTATCT
CCGTCTCGAACTGGCTTCGACTCGAAGATATTGGCATCTTGAACCCCTGTATGGGTGCTAAACACATGAA
GTGGTGGGGGTAGAACGATTACCAAATCCTCTCGGCTACCTGAACAGCCATGACCAACAATGTTGGAGAC
TCTCCCACCCCACCACTTCATCTGTTCTGATTATCTGCACTGTTTCTGTGTGGTTTGGGGGCTCAATAGT
TCGGGTGGTCGCTGGCTCTTAACCATCATTGTCAGTCGTAGACAGATCACACAGCATAGAACAGATGAAG
CCACGGGGTTCTTCACTTATATATTCGGAGAACAGATGAAACAGATGAACCGGTGGATATATCTGGTATA
CAGGTCTGCAACACGT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 1346 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
27  460 F 27  572 -3 2.23e-06 agagagtaca[gt]ttcgta[ct]gct[ct]tcctc
24  791 F 24 1037 -2 4.50e-06 ctaaaca[gc]atgaagt[cg]gtgggggt
24  457 F 24  569 -3 9.89e-05 gt[ct]agagagtaca[gt]ttcgta[ct]gct
24  789 P 24 1127 -3 9.89e-05 atc[ta][ag]aacagatgaagt[cg]gtgggg
19  794 P 19 1127 -1 1.06e-04 aacagatgaagt[cg]gtgggg
19 1040 P 19 1127 -1 1.06e-04 aaca[cg]atgaagtggtgggg
15  460 P 15  525  0 4.75e-04 agagagtacagttcg
20  911 P 20 1040 -2 7.92e-04 ccccca[tc]c[ga]cttcatgtgtt
14 1045 P 14 1127  0 1.90e-03 atgaagtggtgggg
21  912 F 21 1127 -3 4.16e-03 cccca[tc]c[ga]cttcat[gc]tgttct
21  912 P 21 1247 -3 4.16e-03 cccc[ag]t[cg]gcttcat[gc]tgttct
16  183 P 16  725 -1 5.69e-03 ccgatgcga[ca]ggacac
16  799 F 16 1045 -1 5.69e-03 atgaagt[cg]gtgggggt
13  582 R 13  582  0 7.59e-03 tttcgtatgcttt
13 1135 P 13 1247  0 7.59e-03 cttcatctgttct
20   32 F 20   75 -3 1.43e-02 acgaacga[ca]ct[cg]ctcc[ga]tcg
20   39 R 20   46 -3 1.43e-02 acctcc[tg]ccgtc[gt]g[tg]ctgcc
20  520 P 20  572 -3 1.43e-02 gca[gt][ga]cgaa[ca]tgtactctct
20  525 P 20  567 -3 1.43e-02 cgaa[ca]tgtactctct[ca][ca]cgt
12  322 R 12  322  0 3.04e-02 ctcgtggtgctc
12 1136 P 12 1288  0 3.04e-02 ttcatctgttct
12 1247 F 12 1288  0 3.04e-02 agaacagatgaa
17  195 R 17  195 -2 3.63e-02 ac[at]caatcactaac[ta]ca
17 1129 P 17 1299 -2 3.63e-02 ccacc[ag][cg]ttcatctgtt
19  794 F 19 1249 -3 4.85e-02 aacagatgaag[tc]c[ga][tc]gggg
14  919 P 14 1247 -1 7.97e-02 gcttcat[gc]tgttct
11  793 F 11 1298  0 1.21e-01 aaacagatgaa
11  920 P 11 1040  0 1.21e-01 cttcatgtgtt
11  926 R 11  926  0 1.21e-01 gtgttcttgtg
11 1275 R 11 1275  0 1.21e-01 cttatatattc
16   16 F 16 1192 -2 1.28e-01 ggg[ct]ggtcg[gc]tggctc
16  471 F 16  583 -2 1.28e-01 ttcgta[ct]gct[ct]tcctc
18  718 R 18  918 -3 1.63e-01 tg[at]tct[ct]gtgt[ca]cttcgc
18 1039 F 18 1298 -3 1.63e-01 aaaca[cg]atgaa[gc][tc]ggtgg
13  920 F 13 1135 -1 2.96e-01 cttcat[gc]tgttct
13  994 P 13  994 -1 2.96e-01 cttcga[cg]tcgaag
13 1103 P 13 1103 -1 2.96e-01 ccaaca[at]tgttgg
15  151 C 15  548 -2 4.48e-01 cgaa[tg]ccggt[ca]gcgc
15  160 P 15  291 -2 4.48e-01 tcgcgc[ta]cg[ac]cgacg
15  482 F 15 1076 -2 4.48e-01 tcctctc[tg]gct[ga]cct
15  530 P 15  567 -2 4.48e-01 tgtactctct[ca][ca]cgt
15  721 R 15  918 -2 4.48e-01 tct[ct]gtgt[ca]cttcgc
10   24 C 10   63  0 4.86e-01 ggtggctcac
10   75 F 10  510  0 4.86e-01 acgaacgaac
10  479 R 10  479  0 4.86e-01 ctctcctctc
10  794 F 10 1290  0 4.86e-01 aacagatgaa
10  954 P 10  954  0 4.86e-01 gcagcgctgc
10 1124 R 10 1124  0 4.86e-01 ccaccccacc
10 1136 P 10 1299  0 4.86e-01 ttcatctgtt
10 1249 F 10 1299  0 4.86e-01 aacagatgaa
OriC: 1889584..1890203
The size of oriC620 nt
The GC Level of oriC58.39%
DoriCORI10010166
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common827--6.58571.15e-05ACCCCGTCACTTCATCTGTT
Common6483--13.61275.1e-05ACGCCACCACTTCATCTGTT
Common441460--6.920321.23e-05CCCCCATGACTTCATCTGTT
The sequence of oriC
CCCACAGAACAGATGAAGTGACGGGGTGTGGGTGGTCATGGCTCCGTTCTGTCTCTCGAAAAAAACAGAT
GAAGTGGTGGCGTGCCCCGGTCCTCAACTGCCGTCTCACGCGACGTCTGCCTTCCTACCCGAAACCGGTG
TTTGGTCGTCTCGTCTCGCGCCGCGAGGGTTGCGTGCAGACCGTCAGGACCCAGTCCCGAAACCGGTGTC
TGTTCGGCTCGTCTGCTTCTGCGATCGACGCCTGGCTCCCATAGCCCCCGAATGCGGTGTCCACACGGAT
GTTTCTGACTCGGAAGCACGCGAAATGCCCACTCTGTATCAGATCGTCTCAGTCTCTCAGTGGATCCTAT
CTGCTGCTGAAAGACAGTACATCTTGTGTGCCTTTCCCGACTGCATTGGCTTCGATTGGTCGACGAGTCA
CCCCATGCCGATATCGAAAGAACAGATGAAGTCATGGGGGGAGGGAGGACCGGATCGGACCGTTCTGTGT
GGCTCGTTCGACGGCGCGGTTACGGTGATACGACGGACACAATCAACTAACTACATCGATGCTCGCACCG
CTATTCGCGTCTCGCACTCTCCCCCCGTGGTCTGGCGTGTCGCTCGGTCCCCAACGAACA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 620 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
29 127 F 29 195 -3 3.70e-08 cccgaaaccggtgt[tc]tg[gt]tcg[tg]ctcgtct
21   5 F 21 438 -2 4.65e-05 agaacagatgaagt[gc]a[ct]gggg
21   7 F 21  63 -3 8.83e-04 aacagatgaagtg[ag][ct]gg[gc]gtg
21  59 F 21 436 -3 8.83e-04 aaa[ag]aacagatgaagt[gc][ga]tgg
18 207 R 18 207 -2 2.17e-03 gtctg[tc]tcggct[ct]gtctg
12  63 F 12 440  0 6.44e-03 aacagatgaagt
12 529 R 12 529  0 6.44e-03 caatcaactaac
13 154 P 13 154 -1 6.28e-02 ctcgcg[cg]cgcgag
15 195 F 15 256 -2 9.51e-02 cccgaa[at][cg]cggtgtc
14 127 F 14 256 -2 3.30e-01 cccgaa[at][cg]cggtgt
14 142 F 14 210 -2 3.30e-01 tg[gt]tcg[tg]ctcgtct
14 208 F 14 483 -2 3.30e-01 tctgt[tg][ct]ggctcgt
9  23 R  9  23  0 4.12e-01 gggtgtggg
9  43 F  9 479  0 4.12e-01 ccgttctgt
9  86 P  9 464  0 4.12e-01 ccggtcctc
9 218 R  9 218  0 4.12e-01 tcgtctgct
9 252 R  9 252  0 4.12e-01 agcccccga
9 459 R  9 459  0 4.12e-01 ggagggagg
11  87 F 11 604 -1 8.51e-01 cggtcc[tc]caac
11 100 R 11 572 -1 8.51e-01 cc[gc]tctcacgc
11 145 F 11 213 -1 8.51e-01 tcg[tg]ctcgtct
11 148 F 11 564 -1 8.51e-01 tc[tg]cgtctcgc
11 237 R 11 602 -1 8.51e-01 ac[gc]cctggctc
11 452 P 11 578 -1 8.51e-01 ca[tc]ggggggag
13 219 R 13 219 -2 1.13e+00 cgtct[gt]c[tg]tctgc
13 455 R 13 455 -2 1.13e+00 gg[ga]gggaggg[ag]gg
13 486 F 13 596 -2 1.13e+00 gtgt[gc]gctcg[tg]tc
13 537 R 13 537 -2 1.13e+00 ta[ag]ctacatc[ga]at
15   0 R 15 408 -3 1.24e+00 cccac[at]ga[ag]cag[ac]tg
15  37 F 15 473 -3 1.24e+00 at[gc]g[cg][ta]ccgttctgt
15  84 R 15 234 -3 1.24e+00 cc[ct]cggtcc[tg]ca[ag]ct
15 110 F 15 235 -3 1.24e+00 cgacg[tc]ctg[cg]ct[tc]cc
15 145 F 15 150 -3 1.24e+00 tcgtctcg[tc][cg][tc]cgcg
8   2 P  8 481  0 1.65e+00 cacagaac
8  97 R  8  97  0 1.65e+00 ctgccgtc
8 103 R  8 572  0 1.65e+00 tctcacgc
8 151 F  8 567  0 1.65e+00 cgtctcgc
8 157 R  8 157  0 1.65e+00 gcgccgcg
8 240 R  8 602  0 1.65e+00 cctggctc
8 271 C  8 375  0 1.65e+00 cacacgga
8 283 R  8 327  0 1.65e+00 tctgactc
8 335 C  8 414  0 1.65e+00 ctcagtgg
8 392 R  8 506  0 1.65e+00 gcattggc
8 428 P  8 428  0 1.65e+00 cgatatcg
8 455 P  8 578  0 1.65e+00 ggggggag
8 543 P  8 543  0 1.65e+00 catcgatg
10   3 P 10  42 -1 3.09e+00 acagaac[ag]ga
10  33 C 10 190 -1 3.09e+00 ggtca[tg]ggct
10  47 F 10 328 -1 3.09e+00 tc[ta]gtctctc
10  75 F 10 167 -1 3.09e+00 ggt[gt]gcgtgc
OriC: 2846902..257
The size of oriC1113 nt
The GC Level of oriC57.32%
DoriCORI10010162 ORI10010216 ORI10010150
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common202221+31.11497.32e-11ACCCCTTCGTTTCAGGTGGA
Common398417-31.11497.32e-11ACCCCTTCGTTTCAGGTGGA
Common551570-20.96485.06e-09ACCCCTTCGTTTCGCGTGGA
Common10871106-34.0158.22e-12ACCCCTTTGTTTCAAGTGGA
The sequence of oriC
TTGTTACTTTGGGCGTACACGTGCGTAACTCGAACGGATACCGAGCATGACTCCGGAGTACCGCAGTGTC
TCTCGAACACGACGAGCGTTCTGAAGCCGCCGCGCCGACCTCCCCACAGTCTGTCCTCGCCGCAGTAGCC
GTGATTCTGATATAGTGACACGTGCCGCGGGGACGTGAACCACTCGCAAGGCAACACCCCCACCCCTTCG
TTTCAGGTGGAACGGGCCGAAGGGGTGGGTGGGGGGAGACCGCTAGACGGCGGTCGGATGTTAATTGAAT
AGAGAGGGTGAGTAATATTATCCATTTTCTCTCTACTACGGGTTTGATATGCAAATATCTGTGATAAAAC
CACCGCTATACAAAGACTACCGAACCCCCTCCCCTCCTGTTCGCGGCTCCACCTGAAACGAAGGGGTGTG
GGGGAACCGAGACGCAGGGGTTTCCCGTCGAACTGGAGAACGACAGTTAATTACAAGAGAAATCGAGACG
TTACACAAGGTCAATACTCGCTCTACTACCCGAATTCGTCCAAATCGTTATTCGGACATCTCCACGCGAA
ACGAAGGGGTTACTCCCATCGAATTTTCTGTCGGGGACACATCGCACGTCGAGTTCCACTCCAACGACGC
CCGTTGGTCAGTCACCGCCACCGCTCAGTTACTGTCGGTACTCGGTCTCCGACACCCATCCGGCTACCCA
CCATCGTTCAGTCACGCTGCCGCGCAGTTGCCGGCGCAACTCGTTACCCACCACTCGGCCGACTCGACCT
GTTTCGACTCGAGCCGAGCCGACTTTCCGACGCGGCTCGATTCGCCCGTTCGCCATCTGGTTCGTCTCCC
AGCGACCGCCGGTACTGACGACATCGCCGGGGGAGCGAAACTGATACGCGCGGGTTCTCGTGTTGAAACG
GTCCCGCCCGGCCGAGTTCCGGTCGAACGGCGGCGGACGGGTCGGAGAAGTAAGGTTTTTGTACCAACTG
TTCGTTTGGTTCCTTTGCATCATCTGGAATCGCCTTCTTCGGCGTGATGCGTAAATGCCGACTATCACCG
GCTTCACGCACCCTATACGCCGCCGCGGGCGACTATTCCACTTGAAACAAAGGGGTATTCACG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 1113 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/If0plYmDEV/repfind.fasta
25  196 P 25  397 -1 2.32e-08 ccc[ca]caccccttcgtttcaggtgga
21  200 P 21  397  0 7.92e-08 caccccttcgtttcaggtgga
21  201 P 21 1085 -2 1.50e-04 acccctt[ct]gtttca[ga]gtggaa
21  396 F 21  549 -2 1.50e-04 ctccac[cg][tc]gaaacgaaggggt
20  201 P 20  550 -2 5.42e-04 accccttcgtttc[ag][gc]gtgga
20  397 F 20 1086 -2 5.42e-04 tccac[ct]tgaaac[ga]aaggggt
19  682 R 19  682 -2 1.95e-03 cacccatc[cg]g[gc]ctacccac
13  231 R 13  231  0 5.19e-03 ggggtgggtgggg
13  404 F 13  557  0 5.19e-03 gaaacgaaggggt
20  550 F 20 1086 -3 9.75e-03 tccac[gt][ct]gaaac[ga]aaggggt
12  198 P 12  227  0 2.08e-02 cccaccccttcg
14  403 F 14 1092 -1 5.45e-02 tgaaac[ga]aaggggt
11  412 R 11  412  0 8.31e-02 ggggtgtgggg
11  781 R 11  781  0 8.31e-02 agccgagccga
16  227 F 16  408 -2 8.76e-02 cgaaggggtg[gt]g[tg]ggg
13  209 P 13 1085 -1 2.02e-01 gtttca[ga]gtggaa
13  557 F 13 1093 -1 2.02e-01 gaaac[ga]aaggggt
15  427 F 15  556 -2 3.07e-01 cga[ga]acg[ca]aggggtt
10   49 P 10   49  0 3.32e-01 actccggagt
10  377 R 10  377  0 3.32e-01 cctcccctcc
10  779 R 10  779  0 3.32e-01 cgagccgagc
17  105 R 17  677 -3 3.72e-01 cg[ag]cct[ca]cccacag[tc]ct
17  609 F 17  922 -3 3.72e-01 cgagttcc[ag][cg]tc[cg]aacg
17  774 P 17  797 -3 3.72e-01 cga[ca]tcgagccg[ac]g[ct]cg
12  195 F 12  373 -1 7.48e-01 accccc[at]cccct
12  307 F 12  507 -1 7.48e-01 tc[tg]ctctactac
12  441 F 12  926 -1 7.48e-01 ttcc[cg]gtcgaac
14   74 P 14  602 -2 1.06e+00 gaac[at]cgacg[at]gcg
14   94 R 14   94 -2 1.06e+00 agccgc[cg][gc]cgccga
14   98 R 14  777 -2 1.06e+00 gccg[ca]gccga[cg]ctc
14  108 R 14  677 -2 1.06e+00 cct[ca]cccacag[tc]ct
14  211 F 14  926 -2 1.06e+00 ttc[ac]ggt[gc]gaacgg
14  692 R 14  692 -2 1.06e+00 gctacc[ca][ac]ccatcg
14  773 F 14  778 -2 1.06e+00 tcga[cg][tc]cgagccga
14  773 P 14  773 -2 1.06e+00 tcg[ag]ctcgag[ct]cga
16   98 F 16  782 -3 1.23e+00 gccg[ca]gccgac[ct]t[ct]cc
16  230 R 16  233 -3 1.23e+00 ag[ga]gg[tg]gggtggg[gt]gg
16  236 F 16  413 -3 1.23e+00 gggtg[gt]gggg[ag][ga]accg
16  303 F 16  503 -3 1.23e+00 at[ta][tc]tc[tg]ctctactac
16  419 P 16  801 -3 1.23e+00 ggg[gc]gaa[ct]cgag[ac]cgc
16  686 R 16  747 -3 1.23e+00 ca[tg]ccggct[ac][ca]ccacc
9   95 F  9 1068  0 1.33e+00 gccgccgcg
9   98 R  9   98  0 1.33e+00 gccgcgccg
9  147 R  9  147  0 1.33e+00 tgatatagt
9  194 R  9  194  0 1.33e+00 cacccccac
9  196 P  9  236  0 1.33e+00 cccccaccc
9  197 R  9  197  0 1.33e+00 ccccacccc
9  227 F  9  561  0 1.33e+00 cgaaggggt
9  257 P  9  842  0 1.33e+00 cggcggtcg
9  310 F  9  510  0 1.33e+00 ctctactac