Ori-Finder 2 Result - jobID: Hou7J1ldtW (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Nitrosopumilus maritimus SCM1 chromosome, complete genome.
Chromosome size1645259 nt
Chromosome GC Level34.17%
The location of oriCs with ORB sequence1644927..145;
The location of DNA replication genes146..1348; 1542607..1543926;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 1644927..145
The size of oriC478 nt
The GC Level of oriC31.17%
DoriCORI10010053
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common162181-18.28781.33e-08ACCCCTTTATTTCCACTCCA
Common224243-5.683745.76e-07ACCCCCTAATTTCCACTCCA
Common453472--4.801057.67e-06ACACCTTTGTTTCCTATCAA
The sequence of oriC
GTTAGGATCTATTCGATCTGATGTTAACAGTTCAAATGATCCGCGAAAATTTGTTAACTAAATGGTTTGT
TAACATTGACTGTGTAAGCCACGCCTAGTTATTTTTTTGTTATTAACAATTAGTCGTGTATAAGCCCCCT
AAATTAAGAAATATTCATGCCTGGAGTGGAAATAAAGGGGTTAGATTTGAGATATTCACAATGTTAACGT
CAATTTTAACGCCTGGAGTGGAAATTAGGGGGTCAAAATAGGGTTTTTGGGAGTTTTCTTAACATCAAAT
TAACATGGTTGTTAATTTCCAGTGGAACCCACACACCAATATTTCCACTCTTCTTTTTTCTATTTTTTTT
TTGAGAAAAAACAAAAACTAACTAAAAATAATTAATTACAAACTAAACTAGAATTACTATTCTATTCTAT
ACTCTCTTAATTGAGATATGGTTAAGATGAAATTGATAGGAAACAAAGGTGTGTGAGT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 478 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/Hou7J1ldtW/repfind.fasta
23 158 F 23 220 -2 2.08e-06 gcctggagtggaaat[at]a[ag]ggggt
24 149 F 24 211 -3 1.25e-05 aat[at]tt[ca]a[tc]gcctggagtggaaat
20 153 F 20 215 -2 9.99e-05 tt[ca]a[tc]gcctggagtggaaat
13 249 R 13 249  0 9.58e-04 agggtttttggga
17 333 R 17 333 -2 4.58e-03 tttttt[ct]tat[tc]tttttt
11 111 R 11 111  0 1.53e-02 attaacaatta
11 163 P 11 319  0 1.53e-02 gagtggaaata
11 167 R 11 167  0 1.53e-02 ggaaataaagg
11 356 R 11 356  0 1.53e-02 aaaaacaaaaa
11 458 R 11 458  0 1.53e-02 ggaaacaaagg
16  98 R 16  98 -2 1.62e-02 ttatt[tg]tttt[gt]ttatt
16 338 C 16 353 -2 1.62e-02 tct[at]tttt[tg]tttttga
18 330 R 18 333 -3 2.06e-02 tt[ct]tttttt[ca]t[ac]tttttt
13 106 P 13 106 -1 3.73e-02 ttgtta[ta]taacaa
13 165 R 13 458 -1 3.73e-02 gtggaaa[tc]aaagg
15 243 R 15 347 -2 5.66e-02 caaaa[ta]ag[ga]gttttt
15 268 R 15 390 -2 5.66e-02 ttaa[cg]atcaaat[tc]aa
10  68 P 10 198  0 6.13e-02 gttaacattg
10 210 R 10 210  0 6.13e-02 caattttaac
10 225 P 10 320  0 6.13e-02 gagtggaaat
10 331 R 10 331  0 6.13e-02 tcttttttct
10 342 R 10 342  0 6.13e-02 tttttttttt
10 378 P 10 378  0 6.13e-02 taattaatta
17 198 R 17 203 -3 6.87e-02 caat[gt]ttaac[gt][tg]caatt
17 309 P 17 458 -3 6.87e-02 cacacacc[at][at]t[ag]tttcc
17 333 F 17 335 -3 6.87e-02 tttt[tc]t[ca]t[at]tttttttt
17 342 F 17 344 -3 6.87e-02 tttttttt[tg][ta]ga[ga]aaaa
17 344 P 17 344 -3 6.87e-02 tttttt[tc]t[gc]a[ga]aaaaaa
17 393 R 17 436 -3 6.87e-02 taaa[cg]tagaatt[ag][cg]tat
12  15 P 12 268 -1 1.38e-01 at[ct]tgatgttaa
12  68 P 12 208 -1 1.38e-01 gttaa[ca]attgac
12  95 P 12 362 -1 1.38e-01 tagtta[tg]ttttt
12  96 R 12 342 -1 1.38e-01 agtt[at]ttttttt
12  99 F 12 340 -1 1.38e-01 tattttttt[gt]tt
12 101 R 12 340 -1 1.38e-01 ttttttt[gt]ttat
12 102 C 12 355 -1 1.38e-01 ttttttgtt[at]tt
12 342 C 12 357 -1 1.38e-01 tttt[tg]tttttga
12 406 F 12 411 -1 1.38e-01 ctattctat[ta]ct
14 167 F 14 458 -2 1.96e-01 ggaaa[tc]aaagg[gt]gt
14 331 C 14 353 -2 1.96e-01 tctttttt[cg]t[at]ttt
16  11 C 16 389 -3 2.26e-01 tt[ct]gat[ct]tgat[gc]ttaa
16 105 P 16 376 -3 2.26e-01 tttgt[ta]attaa[ct][at]att
16 330 R 16 333 -3 2.26e-01 tt[ct]tttt[ta]tct[at]tttt
16 359 F 16 369 -3 2.26e-01 aac[at]aaaa[ca]taa[ct]taa
16 453 R 16 458 -3 2.26e-01 tg[at][tg][at]ggaaacaaagg
9  18 P  9 268  0 2.45e-01 tgatgttaa
9  20 P  9  67  0 2.45e-01 atgttaaca
9  49 F  9  65  0 2.45e-01 tttgttaac
9 186 F  9 430  0 2.45e-01 ttgagatat
9 228 P  9 292  0 2.45e-01 tggaaatta