Ori-Finder 2 Result - jobID: xPb2gJiloa (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Hyperthermus butylicus DSM 5456 chromosome, complete genome.
Chromosome size1667163 nt
Chromosome GC Level53.74%
The location of oriCs with ORB sequence5011..5539;
The location of DNA replication genes565873..567096; 915555..916790;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 5011..5539
The size of oriC529 nt
The GC Level of oriC46.88%
DoriCORI10010035
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common82101-7.803013.22e-07ACCCCTAGCTTTCCTGTGGA
Common172191+-5.135678.28e-06ACCCCTCAACTTCTAGTGCA
Common388407--5.024138.08e-06ACCCCCCAATTGCCTGTAGA
Common499518--3.797196.09e-06ACCCCTCAGCTTCCACTCCA
The sequence of oriC
TGCTCCCCCCAGACTAGGCTAGTTCTTAGCTAGCCCCTCCTTAAAACTGGCGGGAGACTACTAGCCCCAC
TCTGGGCCCACTCCACAGGAAAGCTAGGGGTCGTATGACGAACTGTTTCACAATAAGAACGAAATATTCA
GCACTAGCATGCACCAATGGTTGACTCTGGCACCCCTCAACTTCTAGTGCAGACAATACAGCATACAAGG
ATGAACTGGTAACTGCATAGCAATTGCAACGCTACTCTAGTTTATACAAACAGGCAAGTTTAAATAAGGG
CCTATAAAGGATATGCGATGTAAATCCATTGTCCAATAATCTGATTCACAACTTGAATGCAAACTGCAAT
ATGTATGTGAGTTCACAATTGTAACTCAGAGCTTCTGTCTACAGGCAATTGGGGGGTGCCAGGGTGTTTC
CATGTGCTACAGCTGGCAGTGATCTTAGAGTCATTGCTGCCGTGATGGGTTTCAGTGTCTTGTGGCCCTA
TGGTGGGCTGGAGTGGAAGCTGAGGGGTTGTTTACCCTA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 529 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/xPb2gJiloa/repfind.fasta
17 163 P 17 398 -2 5.61e-03 ac[tc]ctggcacccc[tc]caa
14 166 P 14 398 -1 1.23e-02 ctggcacccc[tc]caa
16 499 R 16 499 -2 1.98e-02 ggagt[gc]gaag[cg]tgagg
18 251 C 18 347 -3 2.52e-02 ttataca[at]aca[gc][gt]caagt
13 171 P 13 505 -1 4.57e-02 acccctca[ag]cttc
11  12 P 11  12 -1 6.19e-01 actag[gc]ctagt
11 112 F 11 320 -1 6.19e-01 ctg[ta]ttcacaa
13 224 P 13 229 -2 8.23e-01 gc[ag]t[at]gcaattgc
13 310 R 13 310 -2 8.23e-01 gtc[ct]aataa[tc]ctg
15  68 F 15 163 -3 9.00e-01 actctgg[gc][ca]cc[ac]ctc
8  29 F  8  60  0 1.20e+00 ctagcccc
8  72 P  8  72  0 1.20e+00 tgggccca
8  77 P  8 498  0 1.20e+00 ccactcca
8  99 C  8 198  0 1.20e+00 gtcgtatg
8 116 F  8 361  0 1.20e+00 ttcacaat
8 181 R  8 438  0 1.20e+00 ttctagtg
8 259 F  8 390  0 1.20e+00 acaggcaa
8 364 P  8 364  0 1.20e+00 acaattgt
8 399 R  8 399  0 1.20e+00 tggggggt
10   1 P 10 399 -1 2.25e+00 gc[ta]cccccca
10   2 P 10  46 -1 2.25e+00 ctccc[cg]ccag
10 137 P 10 183 -1 2.25e+00 tc[at]gcactag
10 174 C 10 499 -1 2.25e+00 cctca[ac]cttc
10 230 F 10 365 -1 2.25e+00 caattg[ct]aac
12  60 F 12  71 -2 2.79e+00 ct[ag]g[cg]cccactc
12 105 C 12 111 -2 2.79e+00 tgac[ga]aa[cg]tgtt
12 232 R 12 232 -2 2.79e+00 at[tc]gcaacg[ct]ta
12 249 P 12 249 -2 2.79e+00 gttt[ag]ta[ct]aaac
12 319 P 12 368 -2 2.79e+00 tctga[tg]t[ct]acaa
12 355 P 12 355 -2 2.79e+00 tgtga[ga][tc]tcaca
12 398 R 12 459 -2 2.79e+00 ttggg[gt][ga]gtgcc
14  34 P 14 266 -3 2.88e+00 ccct[ct][ca]tt[at]aaact
14 133 P 14 183 -3 2.88e+00 at[at][tg]tc[at]gcactag
14 175 R 14 438 -3 2.88e+00 ct[cg]a[ag][ca]ttctagtg
14 182 F 14 245 -3 2.88e+00 tctagt[gt][ct]a[gt]acaa
14 203 P 14 359 -3 2.88e+00 tacaa[gt][gt][ag]tgaact
9  15 F  9 261 -1 8.11e+00 aggc[ta]agtt
9  17 P  9 139 -1 8.11e+00 gctagt[tg]ct
9  19 P  9 123 -1 8.11e+00 t[ac]gttctta
9  63 F  9  74 -1 8.11e+00 g[cg]cccactc
9  84 F  9 259 -1 8.11e+00 acagg[ac]aag
9  95 F  9 512 -1 8.11e+00 aggggt[ct]gt
9  97 R  9 488 -1 8.11e+00 gggt[cg]gtat
9 101 C  9 338 -1 8.11e+00 cgt[at]tgacg
9 106 F  9 209 -1 8.11e+00 ga[ct]gaactg
9 128 R  9 282 -1 8.11e+00 a[cg]gaaatat
9 136 R  9 325 -1 8.11e+00 ttca[ga]cact
9 140 P  9 181 -1 8.11e+00 gcactag[ca]a
9 141 C  9 438 -1 8.11e+00 cactag[ca]at
9 150 P  9 451 -1 8.11e+00 gca[cg]caatg