Ori-Finder 2 Result - jobID: m4f3aOQNeh (motif: Thermococcaceae; motif count: 3; P-value: 1E-04)
Your Query:Pyrococcus furiosus DSM 3638 chromosome, complete genome.
Chromosome size1908256 nt
Chromosome GC Level40.77%
The location of oriCs with ORB sequence15355..16235; 720986..721319;
The location of DNA replication genes16236..17498;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 15355..16235
The size of oriC881 nt
The GC Level of oriC31.78%
DoriCORI10010186 ORI10010016 ORI10010121 ORI10010003 ORI10010007 ORI10010105 ORI10010079
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Thermococcaceae_motif1112131-33.92611.22e-12TTCCAGTGGAAATGAAACTC
Thermococcaceae_motif1391410+32.81374.73e-12CTCCAGTGGAAATGAAACTC
Thermococcaceae_motif1526545+6.558882.59e-06CTCCACAGGAAATCTGAAGT
Thermococcaceae_motif1536555--8.125999.71e-05TTCTACAGGAACTTCAGATT
Thermococcaceae_motif1593612-1.107681.11e-05TTCCACAGGAAATGAGATAA
Thermococcaceae_motif1602621+3.777665.52e-06TTCCTGTGGAAGTTTTGGGC
Thermococcaceae_motif1625644-20.79882.28e-08TTCCAGTGGAAGTTCCACAC
Thermococcaceae_motif1634653+1.552689.9e-06TTCCACTGGAAAATATTGAC
Thermococcaceae_motif1716735-9.006361.29e-06CTCCATTGGAAATAGAGGAA
Thermococcaceae_motif1725744+-3.342283.32e-05TTCCAATGGAGATACTATAT
Thermococcaceae_motif1813832-24.58124.21e-09TTCCAGAGGAAACATAACAC
Thermococcaceae_motif1854873-20.68752.38e-08CTCCATTGGAAATTGTGCTC
Thermococcaceae_motif2119133+22.05322.53e-09ATTTCCACTGGAACC
Thermococcaceae_motif2389403-11.79152.8e-05ATTTCCACTGGAGCC
Thermococcaceae_motif2524538+16.25311.78e-06GTCTCCACAGGAAAT
Thermococcaceae_motif2543557-15.02624.24e-06ATTTCTACAGGAACT
Thermococcaceae_motif2600614+14.585.7e-06ATTTCCTGTGGAAGT
Thermococcaceae_motif2600614-16.47621.49e-06ACTTCCACAGGAAAT
Thermococcaceae_motif2632646+17.70315.4e-07ACTTCCACTGGAAAA
Thermococcaceae_motif2705719+13.131.37e-05CTTTCCAATGTTTCC
Thermococcaceae_motif2723737-16.25311.78e-06ATCTCCATTGGAAAT
Thermococcaceae_motif2820834+17.48016.5e-07GTTTCCTCTGGAAAA
Thermococcaceae_motif2861875-14.91464.58e-06CCCTCCATTGGAAAT
Thermococcaceae_motif3468487+20.3968.47e-08AATGAACTAAAAGGTGCAAT
Thermococcaceae_motif3502521+27.00379.31e-11AATGACCATAAATGTTCATT
Thermococcaceae_motif3502521-14.0054.57e-06AATGAACATTTATGGTCATT
Thermococcaceae_motif3570589+25.92054.12e-10AATGTCCAAAGATGTTCATT
Thermococcaceae_motif3570589-17.90464.87e-07AATGAACATCTTTGGACATT
The sequence of oriC
ACTTTTTTATCTCCTATTTACTTTGTAACTTTGTAGCTGCAAACCACCTGGGATGCTAAATTTTTCAGCA
AAATATAGAAACGTTTCTATGTTGATCTTAAAAACCCCCCAGAGTTTCATTTCCACTGGAACCAGGTTTT
GAAAGGTAAGCAATTTTCACGAGTATTACATAAGCCAACGCAAAACTTATAAAGAATTTTACATTTATCT
AATGAACATTTATTCAGTAATTAGCCATAATAACTTGTAAAAAAATGAAAAAACTTTCATTATTTTCTGC
TTTCTGTTATAAATACGTTCAAAGAAAAATATTTAAATATGCAGTCTACTTAATATGGGAGAGTGTTTGT
CACCAGAAAAAATTTATTTTTTCTGGTGTTTGCCGCCCGGCTCCAGTGGAAATGAAACTCTGGGGGACTT
CACTTCTGTTTAATAATTGGAAAATGTTAAACAAATTAGATTAATCTAATGAACTAAAAGGTGCAATAAT
GAACAAATTTTAATGACCATAAATGTTCATTTTGTCTCCACAGGAAATCTGAAGTTCCTGTAGAAATATG
TAAACATCAAATGTCCAAAGATGTTCATTCGCTTATCTCATTTCCTGTGGAAGTTTTGGGCTGGGTGTGG
AACTTCCACTGGAAAATATTGACATGTTTTTGTCAAGCAAAGGATAAAAACTCAACAGTTAAAGGAATAG
TTGCCTTTCCAATGTTTCCTCTATTTCCAATGGAGATACTATATATCTATGGCATTTATCATAACTAAAT
TATTACATTTAGTTATATGGATGGGGGAAAAATTAACAACATGTGTTATGTTTCCTCTGGAAAATTGATC
TATAATAATCTAGGAGCACAATTTCCAATGGAGGGTCATCA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 881 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/m4f3aOQNeh/repfind.fasta
25 105 P 25 391  0 1.94e-10 cccccagagtttcatttccactgga
32 101 P 32 388 -3 1.58e-09
aa[ag][ct]cccccagagtttcatttccactgga[ag]cc
28 350 P 28 350 -2 1.03e-08 caccagaaaaaat[ta][ta]attttttctggtg
22  71 P 22  71 -2 2.58e-05 aa[tc]atagaaacgtttctat[ga]tt
16 454 P 16 454  0 5.08e-05 attagattaatctaat
19 198 F 19 455 -2 1.22e-03 tta[cg]att[ta]atctaatgaac
13 210 P 13 508  0 3.25e-03 aatgaacatttat
13 722 F 13 860  0 3.25e-03 atttccaatggag
20 501 F 20 569 -3 6.11e-03 aatg[at]cca[ta]a[ag]atgttcatt
15 202 F 15 459 -1 9.15e-03 att[ta]atctaatgaac
15 600 P 15 630 -1 9.15e-03 tttcc[ta]gtggaagtt
12 308 P 12 308  0 1.30e-02 atatttaaatat
12 526 P 12 599  0 1.30e-02 tccacaggaaat
17 446 C 17 453 -2 1.56e-02 ttaa[at]c[at]aattagatta
17 447 R 17 453 -2 1.56e-02 taa[at]c[at]aattagattaa
17 548 R 17 567 -2 1.56e-02 tgtagaaa[tc][ac]tgtaaac
14 633 F 14 821 -1 3.42e-02 ttcc[at]ctggaaaat
11 120 F 11 633  0 5.20e-02 ttccactggaa
11 206 F 11 463  0 5.20e-02 atctaatgaac
11 246 R 11 246  0 5.20e-02 gtaaaaaaatg
11 446 R 11 446  0 5.20e-02 ttaaacaaatt
11 711 F 11 817  0 5.20e-02 atgtttcctct
16 434 R 16 434 -2 5.49e-02 aattg[gt]aaaa[tg]gttaa
16 558 R 16 558 -2 5.49e-02 tgtaaac[at][ta]caaatgt
18  14 R 18 706 -3 7.00e-02 tat[tc]t[ac]ctttgtaac[tc]tt
13 390 P 13 860 -1 1.27e-01 ctcca[gt]tggaaat
13 390 P 13 722 -1 1.27e-01 ctcca[gt]tggaaat
13 626 P 13 626 -1 1.27e-01 gtggaa[cg]ttccac
15   5 R 15 711 -2 1.92e-01 tttatctcct[at]t[tg]ta
15  13 R 15 194 -2 1.92e-01 ctatttac[ta]tt[gt]taa
15 116 F 15 597 -2 1.92e-01 tcatttcc[at][cg]tggaa
15 198 P 15 454 -2 1.92e-01 tta[cg]att[ta]atctaat
15 209 C 15 239 -2 1.92e-01 ta[at]tgaacattt[at]tt
15 237 R 15 475 -2 1.92e-01 taataac[tg]tg[tg]aaaa
15 248 R 15 248 -2 1.92e-01 aaaaaa[ag]t[ga]aaaaaa
15 506 F 15 574 -2 1.92e-01 cca[ta]a[ag]atgttcatt
10 391 P 10 633  0 2.08e-01 tccagtggaa
10 453 C 10 460  0 2.08e-01 aattagatta
10 760 P 10 776  0 2.08e-01 ataactaaat
17  69 F 17 642 -3 2.33e-01 aaaatat[at]ga[ac]a[ct]gttt
17 209 P 17 255 -3 2.33e-01 taatgaa[ca][ag]ttt[at]ttca
17 236 R 17 830 -3 2.33e-01 ataata[at]ct[ta]gt[at]aaaa
17 245 R 17 797 -3 2.33e-01 tgta[ac]aa[ac]aat[gt]aaaaa
17 250 F 17 484 -3 2.33e-01 aa[at]aatgaa[ac]aaa[ct]ttt
17 253 F 17 487 -3 2.33e-01 aatgaa[ac]aaa[ct]ttt[ca]at
17 721 P 17 721 -3 2.33e-01 tat[tc]tcca[at]tgga[ga]ata
12  20 R 12 706 -1 4.68e-01 ctttgtaac[tc]tt
12 118 F 12 860 -1 4.68e-01 atttcca[ca]tgga
12 118 F 12 722 -1 4.68e-01 atttcca[ca]tgga
12 119 F 12 820 -1 4.68e-01 tttcc[at]ctggaa
OriC: 720986..721319
The size of oriC334 nt
The GC Level of oriC27.84%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Thermococcaceae_motif13150--3.008533.07e-05TTCCTTTGGAAGTACACATC
Thermococcaceae_motif14059+-4.677274.53e-05TTCCAAAGGAAAAACTATTT
Thermococcaceae_motif23852+13.57621.06e-05ACTTCCAAAGGAAAA
Thermococcaceae_motif3132151+14.43833.65e-06AATATTCAAAATTGGGCATT
Thermococcaceae_motif3132151-6.855669.51e-05AATGCCCAATTTTGAATATT
The sequence of oriC
TTTTCTTTTCTTATTTCTCTTTATCGCAAAGATGTGTACTTCCAAAGGAAAAACTATTTTGGAGCTAATT
TTTAGATCTTGTAAAACGATTTTCCTCCCATATTTTCACTTTTGAAAGTATCATTTTTTAGAATATTCAA
AATTGGGCATTTTGTTTGGATTAAGTTCTGTAGATGTTCGATATTCGAATTTTAAATATTTGACATGTGA
AATTTGTAGGTATTTTAAAAGAAACCTTTGACTGAGTGGCTCAAAATTTCGAATGTGAAATAGTAGCGTT
AATAAACTACCCTAATTATTTTAGAATGTCCTAATAAATTTAGGAGGTGCAAAA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 334 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/m4f3aOQNeh/repfind.fasta
13  11 R 13  11  0 4.68e-04 tatttctctttat
19 196 P 19 253 -3 2.99e-03 tattt[gc]acat[gt][tc]gaaattt
11 102 R 11 102  0 7.48e-03 ttttcactttt
16 126 P 16 126 -2 7.89e-03 ttt[at]gaatattc[at]aaa
16 197 P 16 197 -2 7.89e-03 attt[gc]acatgt[gc]aaat
13 131 P 13 187 -1 1.82e-02 aatatt[ct]aaaatt
15 183 F 15 257 -2 2.76e-02 ttcgaat[tg]t[tg]aaata
10   2 R 10   2  0 2.99e-02 ttcttttctt
12  39 R 12 226 -1 6.73e-02 ttccaaag[ga]aaa
12 148 C 12 225 -1 6.73e-02 atttt[gc]tttgga
14 103 P 14 256 -2 9.57e-02 tttcac[ta]tt[tc]gaaa
14 150 C 14 283 -2 9.57e-02 tttg[ta]t[tg]ggattaa
14 290 F 14 309 -2 9.57e-02 cctaat[ta]a[ta]tttag
16  37 C 16 112 -3 1.10e-01 actt[ct]ca[at]ag[gt]aaaaa
16 122 P 16 303 -3 1.10e-01 attt[ta]ttag[ag]a[tc]attc
16 125 F 16 298 -3 1.10e-01 ttttagaat[ag]t[tc]c[at]aa
16 192 P 16 202 -3 1.10e-01 ta[ac]a[ta]attt[gc]acatgt
16 197 F 16 255 -3 1.10e-01 attt[gc][ag][ca]atgtgaaat
9   0 R  9   0  0 1.20e-01 ttttctttt
9 168 R  9 168  0 1.20e-01 tgtagatgt
9 204 F  9 262  0 1.20e-01 atgtgaaat
11  49 F 11  82 -1 2.47e-01 aaaac[tg]atttt
11 182 P 11 253 -1 2.47e-01 attcgaa[ta]ttt
11 185 C 11 248 -1 2.47e-01 cga[ag]ttttaaa
13 188 P 13 193 -2 3.28e-01 at[tg]t[tc]aaatattt
13 202 P 13 253 -2 3.28e-01 acat[gt][tc]gaaattt
13 309 P 13 314 -2 3.28e-01 cct[ac][ac]taaattta
15 127 P 15 299 -3 3.59e-01 ttag[ag]a[tc]attc[at]aaa
8   0 C  8 226  0 4.79e-01 ttttcttt
8   1 P  8 226  0 4.79e-01 tttctttt
8  43 R  8  43  0 4.79e-01 aaaggaaa
8  68 F  8 124  0 4.79e-01 tttttaga
8 122 R  8 122  0 4.79e-01 atttttta
8 136 F  8 250  0 4.79e-01 tcaaaatt
8 182 P  8 182  0 4.79e-01 attcgaat
8 187 R  8 187  0 4.79e-01 aattttaa
8 188 F  8 221  0 4.79e-01 attttaaa
8 190 R  8 313  0 4.79e-01 tttaaata
8 222 P  8 222  0 4.79e-01 ttttaaaa
8 278 C  8 293  0 4.79e-01 ttaataaa
10  36 P 10 110 -1 8.98e-01 tactt[ct]caaa
10  76 P 10 222 -1 8.98e-01 tctt[gt]taaaa
10 106 P 10 135 -1 8.98e-01 ca[ca]ttttgaa
10 125 P 10 220 -1 8.98e-01 tttta[ga]aata
10 134 P 10 254 -1 8.98e-01 attc[ag]aaatt
10 193 C 10 278 -1 8.98e-01 aa[at]tatttga
10 220 F 10 296 -1 8.98e-01 tatttta[ag]aa
10 256 F 10 299 -1 8.98e-01 ttt[ca]gaatgt
12  13 C 12 261 -2 1.11e+00 tt[ta]c[ta]ctttatc
12  19 R 12  47 -2 1.11e+00 tttatc[ga][ca]aaag