Ori-Finder 2 Result - jobID: 3uPrLdYXf0 (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Halobacterium sp. NRC-1 chromosome, complete genome.
Chromosome size2014239 nt
Chromosome GC Level67.91%
The location of oriCs with ORB sequence33916..34650; 919978..920668; 921863..922014; 1806444..1807229;
The location of DNA replication genes920669..921862; 1691265..1692389; 1807230..1808786;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 33916..34650
The size of oriC735 nt
The GC Level of oriC54.15%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common328347+-1.566383.61e-06ACCCCACTGTGTCGAGTGTT
Common489508+-10.71272.82e-05ACACCACCGTTGTAACTGAA
Common562581+0.4413472.22e-06ACACCACCGTTGCAACTGAA
Common635654+0.4413472.22e-06ACACCACCGTTGCAACTGAA
The sequence of oriC
CCGCCACCATATGTTATCACCTCCATACACATAGTCCTGTGGACCAAATACAATGATTCGGGAGTTGGAA
AGCTATTGGCTCGTGGATTGTGTCGTGAATGTCGGCTTCCCCCCACGGCCGACTCGCGTCGCGCGTCCGA
CCAGTCGGAAGCCCTCACTCGTTGAGCCGGGGGCTCCGCCTCGAAAACTGGTAAGCGAGCGGACGAGTAG
TCTCGGTAGCTGCAGGATTCAGATCTTAACCAACACTAGTGAGGGAATGGTGGATGCTGTTGGTTAAGAC
CGGAGACGGAACAGTTCTTGATTCGTCGCTGCTGTTCTTCTCCCCCCACCCCACTGTGTCGAGTGTTCTT
CGGATGGCCCCGTTGTCGGTTCTGTTCGTGCCTCGATTGCTTGTCAGCTCTCCCACCCCACTGCGTCGAA
TGTTCCTCGACGGAACCAGCTCTGTATCTATCCAATCAGTACTCCGTTATTGGTTCAGGTGATGAGACAC
ACCACCGTTGTAACTGAAGCGTGTCCCACTAGTGTTCCTTTTGAGAGAGTTGAGTCTCATCGAAGAGAGA
CACACCACCGTTGCAACTGAAGCGTGTCCCACTAGTGTTCCTTTTGAGAGAGTGGAGTCTCGTCGAAGAG
AGACACACCACCGTTGCAACTGAAACAGGATAGCTGAGACTGCAGCATTGACATCCTCCCCGCCCTGAAG
GGCGAGGATTCCCGACCGCGTTGGGATATTATGGT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 735 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/3uPrLdYXf0/repfind.fasta
98 483 F 98 556 -3 6.21e-48
gagacacaccaccgttg[tc]aactgaagcgtgtcccactagtgttccttttgagagagt
[tg]gagtctc[ag]tcgaagagagacacaccaccgttgcaactgaa
80 501 F 80 574 -2 2.96e-39
aactgaagcgtgtcccactagtgttccttttgagagagt[tg]gagtctc[ag]tcgaag
agagacacaccaccgttgcaactgaa
40 541 F 40 614 -1 1.51e-17
gagtctc[ag]tcgaagagagacacaccaccgttgcaactgaa
32 549 F 32 622  0 8.24e-15 tcgaagagagacacaccaccgttgcaactgaa
25 483 F 25 629 -1 1.01e-08 gagacacaccaccgttg[tc]aactgaa
28 324 F 28 401 -3 1.87e-07 cccaccccactg[tc]gtcga[ga]tgttc[tc]tcg
12 233 P 12 267  0 9.06e-03 tcttaaccaaca
17 228 P 17 267 -2 1.08e-02 tc[ac]g[ag]tcttaaccaaca
11 172 R 11 172  0 3.62e-02 gctccgcctcg
11 302 R 11 302  0 3.62e-02 tcgtcgctgct
11 530 R 11 530  0 3.62e-02 ttgagagagtt
18 686 P 18 690 -3 4.87e-02 tcc[ct]cgccct[gt][ac]agggcg
15 320 R 15 320 -2 1.34e-01 tc[ca]ccccacccc[ac]ct
15 337 F 15 414 -2 1.34e-01 gtcga[ga]tgttc[tc]tcg
10 241 P 10 516  0 1.45e-01 aacactagtg
10 241 P 10 589  0 1.45e-01 aacactagtg
10 531 R 10 603  0 1.45e-01 tgagagagtt
17 120 P 17 120 -3 1.62e-01 gac[tg]cgcg[ta]cgcg[ca]gtc
17 132 P 17 135 -3 1.62e-01 gc[gt]tccgac[ct][ag]gtcgga
14 237 P 14 516 -2 4.64e-01 aa[cg][cg]aacactagtg
14 237 P 14 589 -2 4.64e-01 aa[cg][cg]aacactagtg
14 495 C 14 671 -2 4.64e-01 cgt[tc]gtaactg[at]ag
14 520 R 14 593 -2 4.64e-01 agt[gt]ttcctt[tg]tga
14 520 R 14 520 -2 4.64e-01 agt[gt]ttcctt[tg]tga
14 544 P 14 617 -2 4.64e-01 tctc[at]tcga[ac]gaga
14 544 P 14 544 -2 4.64e-01 tctc[at]tcga[at]gaga
14 593 R 14 593 -2 4.64e-01 agt[gt]ttcctt[tg]tga
14 617 P 14 617 -2 4.64e-01 tctc[gt]tcga[ac]gaga
16 219 F 16 669 -3 5.35e-01 ctgcag[gc]att[cg]a[gc]atc
16 326 R 16 395 -3 5.35e-01 caccccac[tc][gc]t[gc]tcga
9  24 R  9  24  0 5.80e-01 atacacata
9  56 C  9 148  0 5.80e-01 ttcgggagt
9 107 F  9 320  0 5.80e-01 tccccccac
9 292 R  9 292  0 5.80e-01 agttcttga
9 604 R  9 604  0 5.80e-01 tgagagagt
11 151 P 11 244 -1 1.20e+00 ccctcact[ca]gt
11 188 R 11 250 -1 1.20e+00 tggtaag[cg]gag
11 320 R 11 401 -1 1.20e+00 tc[ca]ccccaccc
11 480 P 11 540 -1 1.20e+00 gatgagac[at]ca
13 304 F 13 364 -2 1.59e+00 gtcg[cg]t[gt]ctgttc
13 359 F 13 463 -2 1.59e+00 ccgtt[ga]t[ct]ggttc
13 397 C 13 605 -2 1.59e+00 ctctc[ct]cacc[ct]ca
15 130 F 15 581 -3 1.74e+00 gcg[ct]gtcc[gc]ac[ct]agt
15 130 F 15 508 -3 1.74e+00 gcg[ct]gtcc[gc]ac[ct]agt
15 688 C 15 699 -3 1.74e+00 cccgc[ct]c[tc][gt]aagggc
8 243 F  8 589  0 2.32e+00 cactagtg
8 243 F  8 516  0 2.32e+00 cactagtg
8 243 P  8 243  0 2.32e+00 cactagtg
8 284 F  8 428  0 2.32e+00 gacggaac
8 312 F  8 343  0 2.32e+00 tgttcttc
OriC: 919978..920668
The size of oriC691 nt
The GC Level of oriC65.12%
DoriCORI10010135
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common456475+-1.454843.51e-06CACCCCGTATTTCGAGTGTT
The sequence of oriC
ACTCCCTTGGTCCGCCGCTGGCCTCAAAACGGTTTCTCAATCCGGCCGCTGGTCGCGGTCCCCCACCCCA
AGTCTCAAGTGTTAGTCGGCGAAACCCCGGGCCAGATTGAACAGGGCCTCTCGGTCGACAGTCCGTTCCC
AGTAGCGGTCGGGACGCGACTGTGCGGCCGGCTCGCCGGCTGTGGGCGGCACGCGATCCGACTCGGCCGG
GGTCAAGCGAGTGGCTCGGGCTGGGACGGGCGAGGAGCACGTCGTGTTGGCGGTGGTGCCGTAACTGCCC
GCGAAGGACGTCGAGAAGCGGTGAGGCTGGGATTCGAACCCAGGAGGCGTGACGCCACCGGTTTTCAAGA
CCGGCGCAATAGGCCGCTCTGCCACCTCACCGTACACGACGCGATTGAACGGGGGGAGGGTTGAAACTGT
CGTTGTCCGGCGAGCCCGGGGTCGGCTCTCCCACCCACCCCGTATTTCGAGTGTTTTGCGGTGCGGACAC
CCCACCCACCCCCTCCCCCACCCCGATCTGCAAATGTTCGACTGTGTGCTCCGGGGGCCACCCCCCAACG
GTGGCAGGGATCGGTGACACCGTGTCATCGGTTTGCACTGCCGCGGTCCGGATCCCGACGAAACACCCGA
AACAGCCGAAACACGAGAACCAAAGTGTTATGAAACGGTGGGTAGAAACTCTCGGCAAGCG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 691 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/3uPrLdYXf0/repfind.fasta
19 494 R 19 494  0 4.89e-07 cccaccccctcccccaccc
16 445 R 16 489 -1 1.50e-03 ctc[tc]cccacccacccc
16 618 F 16 627 -1 1.50e-03 cgaaaca[cg]ccgaaaca
13 489 R 13 489  0 2.00e-03 ccccacccacccc
20 541 R 20 545 -3 3.76e-03 cgg[gt]ggc[ca]acccccca[ac]cgg
12 449 R 12 489  0 8.00e-03 cccacccacccc
12 449 F 12 490  0 8.00e-03 cccacccacccc
17 252 R 17 252 -2 9.57e-03 cgtg[tg]tggcggt[gt]gtgc
19 571 P 19 571 -3 1.28e-02 cg[ga]tgacac[cg]gtgtca[tc]cg
14 355 C 14 420 -1 2.10e-02 gcaa[tc]aggccgctc
11  58 F 11 503  0 3.20e-02 tcccccacccc
11 449 R 11 449  0 3.20e-02 cccacccaccc
16 650 R 16 650 -2 3.38e-02 caaagt[ga]tt[ag]tgaaac
18 404 F 18 666 -3 4.31e-02 gg[at]gggt[ta]gaaact[gc]tcg
15  41 R 15  46 -2 1.18e-01 cc[gt]g[cg]cgctggtcgc
15 226 R 15 226 -2 1.18e-01 cgggc[ta]ggg[at]cgggc
15 407 F 15 669 -2 1.18e-01 gggt[ta]gaaact[gc]tcg
15 499 R 15 499 -2 1.18e-01 cccc[ta]ccccc[at]cccc
10  58 R 10 494  0 1.28e-01 tcccccaccc
10 169 P 10 426  0 1.28e-01 ggctcgccgg
17 322 P 17 322 -3 1.44e-01 gg[at]ggcgt[gc]acgcc[at]cc
17 337 P 17 337 -3 1.44e-01 ccggt[tc]tt[cg]aa[ga]accgg
12 104 F 12 392 -1 2.88e-01 gattgaac[ag]ggg
12 162 R 12 201 -1 2.88e-01 tg[cg]ggccggctc
12 167 R 12 361 -1 2.88e-01 ccg[gt]ctcgccgg
12 464 P 12 620 -1 2.88e-01 tttcg[ag]gtgttt
14 166 P 14 166 -2 4.10e-01 gccggc[tg][ca]gccggc
14 369 R 14 369 -2 4.10e-01 tgccac[ct][tc]caccgt
14 430 P 14 430 -2 4.10e-01 cga[gc]cccggg[gc]tcg
14 489 R 14 500 -2 4.10e-01 ccccaccc[ac]c[ct]ccc
14 494 F 14 500 -2 4.10e-01 ccc[at]ccccc[ta]cccc
14 527 C 14 633 -2 4.10e-01 tcg[ag]ct[gt]tgtgctc
14 605 P 14 605 -2 4.10e-01 gtc[cg]ggatcc[cg]gac
16 360 C 16 425 -3 4.73e-01 aggccgctc[tg]g[cg]c[ac]cc
16 460 P 16 629 -3 4.73e-01 cgt[ag]tttcg[ag][gc]tgttt
16 618 F 16 636 -3 4.73e-01 cgaaacac[cg][ca]gaa[ac]ca
9  60 R  9  60  0 5.12e-01 ccccacccc
9  60 R  9 505  0 5.12e-01 ccccacccc
9  61 R  9 488  0 5.12e-01 cccacccca
9  93 P  9 433  0 5.12e-01 accccgggc
9 165 R  9 201  0 5.12e-01 ggccggctc
9 401 C  9 498  0 5.12e-01 gggggaggg
9 401 P  9 500  0 5.12e-01 gggggaggg
9 453 F  9 506  0 5.12e-01 cccaccccg
9 505 R  9 505  0 5.12e-01 ccccacccc
9 540 R  9 540  0 5.12e-01 ccgggggcc
9 557 R  9 557  0 5.12e-01 acggtggca
11  30 C 11 649 -1 1.06e+00 ggtttc[ta]caat
11  36 P 11  99 -1 1.06e+00 tcaatc[ct]ggcc
11 201 R 11 437 -1 1.06e+00 ctcggc[ct]gggg
OriC: 921863..922014
The size of oriC152 nt
The GC Level of oriC62.50%
DoriCORI10010136 ORI10010008
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common2342--5.135678.28e-06CACCCCGGATTTCGAGTGTT
Common127146--14.39355.96e-05CACCCCGGATTTCGAATGTT
The sequence of oriC
ACCCCGGACTGTGCTCTGGAGAAACACTCGAAATCCGGGGTGGGGGTGTTCGCCCGCACCATGTTATTTG
CTGTCATCCTGCAGTGGTCCCCACACCCCACCCCACCCCACCGAATCAGCACGCCCAACATTCGAAATCC
GGGGTGGGGGGG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 152 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/3uPrLdYXf0/repfind.fasta
24  22 F 24 126 -1 1.66e-09 aaca[ct]tcgaaatccggggtggggg
19  27 F 19 131  0 2.36e-08 tcgaaatccggggtggggg
18  93 R 18  93  0 9.46e-08 caccccaccccaccccac
15  97 R 15  97  0 6.05e-06 ccaccccaccccacc
17  90 F 17  95 -1 1.93e-05 cc[ac]caccccaccccacc
14  93 F 14  98  0 2.42e-05 caccccaccccacc
19  90 R 19  90 -2 3.64e-05 cc[ac]caccccaccccac[ca]cc
11  88 R 11  88  0 1.55e-03 ccccacacccc
16  88 R 16  88 -2 1.63e-03 ccccac[ac]cc[ca]cacccc
10 102 R 10 102  0 6.20e-03 ccaccccacc
12  90 F 12 100 -1 1.39e-02 cc[ac]caccccacc
12  95 C 12 140 -1 1.39e-02 ccccacccc[ac]cc
12  97 P 12 140 -1 1.39e-02 cc[ac]ccccacccc
12 100 C 12 140 -1 1.39e-02 ccccacccc[ac]cc
14  90 R 14  90 -2 1.98e-02 cc[ac]caccccac[ca]cc
9  36 R  9  36  0 2.48e-02 ggggtgggg
9  36 R  9 140  0 2.48e-02 ggggtgggg
9  36 C  9 100  0 2.48e-02 ggggtgggg
9  36 C  9  95  0 2.48e-02 ggggtgggg
9  36 P  9 100  0 2.48e-02 ggggtgggg
9  36 P  9  95  0 2.48e-02 ggggtgggg
9  39 R  9  39  0 2.48e-02 gtgggggtg
9  93 F  9 103  0 2.48e-02 caccccacc
9  95 P  9 140  0 2.48e-02 ccccacccc
9 100 P  9 140  0 2.48e-02 ccccacccc
9 140 R  9 140  0 2.48e-02 ggggtgggg
11  88 C 11 140 -1 5.11e-02 ccccac[ac]cccc
11  88 P 11 140 -1 5.11e-02 cccc[ac]cacccc
8   0 P  8 137  0 9.92e-02 accccgga
8   0 P  8  33  0 9.92e-02 accccgga
10  36 C 10  88 -1 1.86e-01 ggggtg[gt]ggg
10  36 P 10  89 -1 1.86e-01 ggggtg[gt]ggg
10 102 P 10 142 -1 1.86e-01 cc[ac]ccccacc
12  37 P 12  92 -2 2.30e-01 ggg[tg][gt]ggggtgt
12  90 C 12 140 -2 2.30e-01 cc[ac]cacccc[ac]cc
12 140 R 12 140 -2 2.30e-01 gggg[tg]gg[gt]gggg
14  88 R 14  95 -3 2.38e-01 ccccac[ac]cc[ca]c[ac]cc
14  88 F 14  95 -3 2.38e-01 ccccac[ac]cc[ca]c[ac]cc
9  36 C  9  90 -1 6.69e-01 gg[gt]gtgggg
9  36 P  9  88 -1 6.69e-01 gg[gt]gtgggg
9  39 R  9 143 -1 6.69e-01 g[tg]gggggtg
9  52 R  9 117 -1 6.69e-01 cccgcac[cg]a
9  88 F  9 100 -1 6.69e-01 ccccac[ac]cc
9  88 P  9 140 -1 6.69e-01 ccccac[ac]cc
9  93 C  9 143 -1 6.69e-01 cacccc[ac]cc
13 100 P 13 139 -3 7.48e-01 cccc[ac]cc[ca]c[ac]ccg
13 138 F 13 139 -3 7.48e-01 c[cg]ggg[gt][tg]gggggg
11  37 C 11 100 -2 7.67e-01 ggg[tg][gt]ggggtg
11  37 C 11  95 -2 7.67e-01 ggg[tg][gt]ggggtg
11  37 P 11  98 -2 7.67e-01 ggg[tg][gt]ggggtg
OriC: 1806444..1807229
The size of oriC786 nt
The GC Level of oriC59.67%
DoriCORI10010137 ORI10010009
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common207226+29.33031.84e-10ACCCCTTCGTTTCGGGTGGA
Common420439-31.3386.63e-11ACCCCTTCGTTTCGAGTGGA
Common466485+9.253032.14e-07CAACCTCTGTTTCAGGTGGA
Common653672+4.679887.51e-07GACCCACTGTTTCATCTGCA
Common755774-27.76873.76e-10ACCCCCTTGTTTCGGGTGGA
The sequence of oriC
GCCTTGTATGTTTGACGCAGGACGTGTCTGGATGCGTATAAAACCCCAGTGAGAGGGCGTAAAATCCGTC
AGACGAGGGTCTGACCGTGGTCAGATCGAACCCCGGCTCCGGGATCGACGCCGAGACGAGAGCGCACCCC
GTCAGCCACGATGCAGCCACACCCACGACAGGCGATATCAACACACACGAACATCCACAACCCCCCACCC
CTTCGTTTCGGGTGGAACTCCAGAACAGGGACGGCCCCGGCCCACCCGCCAGCCAAGATCAGCGCCCGAA
CGCAACTAGAACTAGACAACTACCGTATTCTGCTCCTAGTTTTTGCTAGTTTGCGGTTGTTGTTCTGATT
GTAGGGACTTAGTAGTACCGCTACTCTAGAAGGGGGGTGGGGACCCCCCACCCCACAGAAGACTCTCGTT
CCACTCGAAACGAAGGGGTGGGGGGTTGGCAGCCACGTTTGACCTCAACCTCTGTTTCAGGTGGAACGGC
GATTCATCGTCTTTCTCCGCGGGTCGCCCCGGCTGGTTCCGGACCGCATCCCTCCCCCCTCTAACCGGCG
GGACATCGGATGGCGGGCGCCCTGGTATCGGGTTGCTGTGATCGTGCCTGCCCGGAAGCGTCCCCGCTAT
CGTAACTTATTAGTCCGACTCGGACCCACTGTTTCATCTGCATCAACTGGAACGCTGTCGGAGCGGGGAC
GCTATACCGCCCGCTGATGGCCTTGCTGGCCGTTCTCTCTTCCCGACTGCGTATTCCACCCGAAACAAGG
GGGTGTGCGTGAATAC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 786 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/3uPrLdYXf0/repfind.fasta
31 197 P 31 417 -1 3.50e-12 caaccccccaccccttcgtttcg[ga]gtggaac
22 205 P 22 753 -2 2.05e-05 cacccc[tc]t[ct]gtttcgggtggaa
22 418 F 22 753 -3 4.11e-04 ttccac[tc]cgaaac[ga]a[ag]ggggtg
21 383 P 21 383 -3 1.42e-03 ggggtgggg[ag][cg][ct]ccccacccc
13 214 P 13 753  0 2.59e-03 gtttcgggtggaa
12 199 F 12 392  0 1.04e-02 accccccacccc
12 200 C 12 381  0 1.04e-02 ccccccacccct
12 381 R 12 433  0 1.04e-02 ggggggtgggga
12 392 P 12 434  0 1.04e-02 accccccacccc
12 616 P 12 691  0 1.04e-02 agcgtccccgct
17 391 R 17 391 -2 1.24e-02 gac[ca]ccccacccc[ac]cag
17 728 R 17 728 -2 1.24e-02 gcc[gc]ttctctctt[cg]ccg
19 209 F 19 468 -3 1.65e-02 cct[tc][ct]gtttc[ga]ggtggaac
14 214 F 14 473 -1 2.72e-02 gtttc[ga]ggtggaac
14 472 P 14 753 -1 2.72e-02 tgtttc[ag]ggtggaa
11 381 C 11 393  0 4.14e-02 ggggggtgggg
16  79 P 16  79 -2 4.37e-02 tctgacc[ga][tc]ggtcaga
18 468 P 18 753 -3 5.57e-02 cc[tc][ct]tgtttc[ag]ggtggaa
13 642 P 13 642 -1 1.01e-01 gtccga[cg]tcggac
15 137 F 15 254 -2 1.53e-01 cccg[tc]cagcca[ca]gat
15 152 R 15 152 -2 1.53e-01 gca[gc]ccacacc[cg]acg
15 416 P 15 473 -2 1.53e-01 cgttccac[tc][ct]gaaac
15 425 F 15 760 -2 1.53e-01 cgaaac[ga]a[ag]ggggtg
15 511 R 15 511 -2 1.53e-01 ggtcg[cg]ccc[gc]gctgg
10 241 R 10 241  0 1.66e-01 cggccccggc
10 541 R 10 541  0 1.66e-01 ctcccccctc
10 569 C 10 704  0 1.66e-01 atggcgggcg
17 319 R 17 487 -3 1.86e-01 ttt[tc]tgcta[gc]tt[ta]gcgg
17 387 P 17 434 -3 1.86e-01 tg[gc][gc][ga]accccccacccc
12 199 R 12 395 -1 3.73e-01 ac[ca]ccccacccc
12 250 R 12 391 -1 3.73e-01 cccaccc[gc]ccag
12 263 R 12 280 -1 3.73e-01 caagatca[ga]cgc
12 395 C 12 434 -1 3.73e-01 ccccacccc[ac]ca
14 200 P 14 378 -2 5.30e-01 cccc[ca]c[ac]ccccttc
14 250 C 14 435 -2 5.30e-01 cccaccc[gc]cca[ga]cc
14 378 F 14 431 -2 5.30e-01 gaagggg[gt]g[tg]gggg
14 435 R 14 435 -2 5.30e-01 gg[gt]tggggggt[tg]gg
14 579 P 14 757 -2 5.30e-01 ccct[gt]gt[at]tcgggt
14 721 R 14 721 -2 5.30e-01 cttgc[tc]gg[ct]cgttc
16 193 C 16 433 -3 6.12e-01 tcc[ac]ca[ac]ccccc[ca]acc
16 381 P 16 388 -3 6.12e-01 gggg[gt]g[tg]gggg[at]cccc
9   3 R  9   3  0 6.63e-01 ttgtatgtt
9 202 R  9 395  0 6.63e-01 ccccacccc
9 202 R  9 202  0 6.63e-01 ccccacccc
9 202 C  9 434  0 6.63e-01 ccccacccc
9 202 P  9 383  0 6.63e-01 ccccacccc
9 249 R  9 249  0 6.63e-01 gcccacccg
9 383 R  9 383  0 6.63e-01 ggggtgggg
9 383 F  9 434  0 6.63e-01 ggggtgggg
9 434 R  9 434  0 6.63e-01 ggggtgggg