Ori-Finder 2 Result - jobID: AY78Edfitg (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Pyrococcus horikoshii OT3 chromosome, complete genome.
Chromosome size1738505 nt
Chromosome GC Level41.88%
The location of oriCs with ORB sequence110790..111561; 861697..874032;
The location of DNA replication genes109476..110789;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 110790..111561
The size of oriC772 nt
The GC Level of oriC30.70%
DoriCORI10010007 ORI10010101 ORI10010003 ORI10010186 ORI10010016 ORI10010121
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common420439+-9.820372.33e-05CCCCCAGGGTTTCATTTCCA
Common425444+-10.26652.57e-05AGGGTTTCATTTCCACTGGA
Common436455--0.2278952.62e-06CTCCCCCGAGTTCCAGTGGA
Common709728--10.26652.57e-05AGGGTTTCATTTCCACTGGA
Common714733--9.820372.33e-05CCCCCAGGGTTTCATTTCCA
The sequence of oriC
TGGAAATATAACACTAATCGCTATTTAATTTTCTTTTAATAGCACATTAAGACATGAACAGCTTTTGAAA
TTGGAACGTTATTGTCAAATTTTCCATAGGAAACATTGGAACCATTGGAAAGCAACCTAATTCTCACCTC
AACAGTTTTTATCCTTTATTTGACAAATGCATGTCCAAAAAATGAAAAATATCTCATATAATCTTCCAAT
AGAAGCTACATAATTTTCCAGGAGAAGCAGGGGATGCAATGATCAATGCTGTGCATTTCATGTTTACATT
GTAGTATCTTCGATCCGATTTCCTTTGGAAGTTAAATGCACATAAATGTTCATTCAGACATGGACGTTAA
GGCATATAAATGAGTATTAAGTTAACTTAATTTGTTTACTAAAATCAGAAATTTAAACAGAAGTGAAGTC
CCCCAGGGTTTCATTTCCACTGGAACTCGGGGGAGACACCGAGAGAATATTAATTTTTATTTCTGACAAG
ACACTCTCCCATACTAGTTGGTTCTCCTATTTAAATATTTTTCTATGAACATAATATAAAAGTAAAGATT
ATTTTATTAGAAAAATGTTCATTTAGAGTGAACAAATATGTACATTTAATGAACAGTTGTATATTTACAA
AAGTAAAGAAATCGGAGTTAAATATTTACTAACATAAAAGAGACTAATTTTTGCTGGGGTATTGTCCTCC
CAGTATTCTCCAGTGGAAATGAAACCCTGGGGGTTTTAAAATAATTATCGAAACGGTTAAAAAATAATAA
AA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 772 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/AY78Edfitg/repfind.fasta
25 419 P 25 708  0 1.49e-10 cccccagggtttcatttccactgga
29 415 P 29 708 -2 2.12e-09 aa[ga][ta]cccccagggtttcatttccactgga
20 553 R 20 553  0 1.52e-07 aaagattattttattagaaa
16 365 P 16 365  0 3.90e-05 attaagttaacttaat
15  25 R 15  25  0 1.56e-04 taattttcttttaat
21 311 P 21 588 -3 1.37e-03 ttaaatg[ct]acata[at][at]tgttca
15 323 F 15 572 -1 7.02e-03 aaatgttcatt[ct]aga
12 760 R 12 760  0 9.99e-03 aaaataataaaa
17  94 F 17 103 -2 1.19e-02 cat[at]ggaa[ac]cattggaa
19 197 F 19 219 -3 1.60e-02 ataat[ct]ttcca[ag][tg]agaagc
19 526 P 19 557 -3 1.60e-02 atttttcta[ta][gt]aa[ca]ataat
14 544 F 14 625 -1 2.62e-02 ta[tc]aaaagtaaaga
11 547 F 11 628  0 4.00e-02 aaaagtaaaga
13  98 F 13 107 -1 9.74e-02 ggaa[ac]cattggaa
15  44 F 15 330 -2 1.48e-01 catt[ac]agacatg[ag]ac
15 140 R 15 151 -2 1.48e-01 aacagttt[ta]t[at]tcct
15 154 F 15 562 -2 1.48e-01 tttatt[ta]ga[ca]aaatg
15 312 R 15 312 -2 1.48e-01 taaat[ga]cac[ag]taaat
15 570 F 15 593 -2 1.48e-01 aaa[at]atgt[ta]cattta
10 208 C 10 284  0 1.60e-01 atagaagcta
10 352 C 10 618  0 1.60e-01 catataaatg
10 387 R 10 387  0 1.60e-01 actaaaatca
10 517 P 10 517  0 1.60e-01 tatttaaata
10 520 F 10 647  0 1.60e-01 ttaaatattt
10 648 P 10 648  0 1.60e-01 taaatattta
17 472 C 17 546 -3 1.79e-01 atttt[tc]atttct[ga]a[ct]aa
17 598 P 17 598 -3 1.79e-01 tgt[at]catt[ta]aatg[at]aca
17 614 F 17 645 -3 1.79e-01 agtt[ga][ta]atatttac[at]aa
17 620 F 17 651 -3 1.79e-01 atatttac[at]aa[ac][ga]taaa
12  91 P 12 298 -1 3.60e-01 ttcca[ta]aggaaa
12 140 R 12 477 -1 3.60e-01 aacagt[tc]tttat
12 176 R 12 628 -1 3.60e-01 aa[ag]aaatgaaaa
12 293 P 12 634 -1 3.60e-01 tccgatttc[ct]tt
12 318 C 12 618 -1 3.60e-01 ca[ct]ataaatgtt
12 467 P 12 757 -1 3.60e-01 tatta[at]ttttta
12 523 P 12 567 -1 3.60e-01 aa[tc]atttttcta
14   0 R 14 539 -2 5.11e-01 tg[ga]aaatataa[ct]ac
14  19 F 14 214 -2 5.11e-01 gcta[tc][ta]taattttc
14  20 P 14 396 -2 5.11e-01 ct[ag]tttaa[ta]tttct
14  28 C 14 179 -2 5.11e-01 ttt[ta]ctttt[at]atag
14 176 R 14 757 -2 5.11e-01 aaa[at]aat[ga]aaaaat
14 197 R 14 197 -2 5.11e-01 ataa[tc]cttc[ct]aata
14 245 P 14 245 -2 5.11e-01 gca[at]tgatca[at]tgc
14 314 F 14 348 -2 5.11e-01 aa[tg]gca[ct]ataaatg
14 537 R 14 758 -2 5.11e-01 aa[ca]ataata[ta]aaaa
14 616 P 14 616 -2 5.11e-01 ttgta[ta]at[ta]tacaa
14 731 F 14 754 -2 5.11e-01 ggtt[ta][ta]aaaataat
16  20 F 16 516 -3 5.90e-01 ctatttaa[ta]t[ta]t[ct]ttt
16  21 C 16 540 -3 5.90e-01 tatt[ta][at]attttc[ta]ttt
16  23 P 16 756 -3 5.90e-01 ttt[at]att[ta]t[ct]ttttaa
OriC: 861697..874032
The size of oriC12336 nt
The GC Level of oriC42.66%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common73617380--2.45874.45e-06AACCCTGGAATTTAAGTGGA
Common84798498+-15.7327.75e-05AGCCATTCATATCCACTTAA
Common89458964--16.06668.28e-05AACCAAGGAATTCAATTGGA
Common1141111430+-16.84749.62e-05AAACCCCTACTTCAGCTAAA
Common1160011619+-13.50124.99e-05ACCCCTTAACATCACCTGAA
The sequence of oriC
GTCATGTTCCTGGGGAATAATATCTCCACAAGTGGGGGTATTTTATCCTCAACTTTTCTAGCCCTACCGG
ATAATATGACTTCTTGGGTTAACTTCAGGGTTACCCTGGTGTAGTTCATAATTCCAACGATAGTTGCGTT
CCTCTCGTACTCTGCACTCATCTCGCCAATGTCATTCTTAAGGTTCTTTTCAACGCTTATCAAGCTCCAG
TTTTCTACGTTAACTTCTATGATTTCCTCAAAGTATTCTAGAGGAAGCGTAACGTTCCTCAACGTTAGAT
TAACCCAGACCTCAAAGTCTTTCAGGAAGTCCTTCCAAGATGTTGTGTTGTAGAATCCGAAATCTTTTGT
ATAGGAATACTCCTTGACCATCGTTAGGGTCGAACTACCGAAGACAACTACCTCCTTGCTTATGCTTGAG
CTTAAGTTGTAGCTATCCCATACCGTCAGCGTAACGTTGTACCTTCCTCCCTTCCTATAAGTGTGGGTTG
GATTTACTAATAAACTCGATTCATTGTCACCGAAATCCCATAGGTACTTTGAGATACCATCTTCATCACT
TGCATTTGCTTCAAACTTAACTGTGAGGTTATCTACCTCCCAGGAGAAGTCAACGCTTGGAGGCTCATTC
ACCCTGAATATGACACTTTTACTCACATTGTAGCTGACATCCCACGCGTAAATGGTGAAGTTGTGCCATC
CATAGTCCAGCTTGATAAACCCGGAATAGCTTGCATTTGAAGATATTAGCTCTCCATTCAAATAAGCTAC
AACCCCTACTAGATCGTGGTTAACGACTGTATAGTTTATCATTACCTCCCTCGAATTGTATACCTTCTCT
TCAGGGCTTTCTATGTATATCACTGGGGCCTCCGGGTTTAAGTAAATCCAGAGACTTACATTACCCCTAT
TCCCAAATTCATCTTCCGCGTATATAGCTACAGTGTTGTTTCCGATGTTGAGTGGAACTATCCCCTCCCA
AGTGGAGCAGGTTCCGTTGCTTTCTACCTCCGTGAATTCCTTTGTATAGTTTCCTACCGCTCCCCAGACT
AAAGTTATTCCCGTTTCATCGCAGGTTCTAACTTGAATCTTGGGTATCTCCGAATAAATTCCACTACTTG
GGGTTACGTTAAGAGTTGGAGGAGATTCATCGAGCTCATGAGTGGCATTTCCAAGGAGAACAACCAACTG
AGTTACGTTTACAATTAAGTATTTGAACTCTTCTAAGCCCTCAACTCTTACCCTTCTTGCATAGGTAGCG
TTTATCCATCCCCATCCCTTTGTTATATTCAGCATCTCTGAATAGTTCAGTAAGCTCCAGTTTCCTGGGA
AGTAGTTCAGGACCTTAAAGTTAACTTTAGGAAGTTCTATTGTCGAAAGCGCCTCTTCAACCCAGCCCTC
AAAGTCTCTCTTGAATTCATTCCAGTAGAAGGATTTGTAATGACCGAAGTCCTTCTCTTTAATGTAATTT
TCAGTTAAGTTCCCATATACCTTCCTGTATGCAGTTACTGTTTTCGATAAGTTGTTAGCTGTGACTGTGT
AATTACCTTCCTTCCTTATCTCAACCGTGGAATTGATAACCTTCCACCTTCCACTCTCTATTATTTCGCT
TCCCTCGGCTATCGTACTGTTTCCTAACTTAATAATATAAGAGTACTCACCACTCACATCCCCAACGTTC
GTCACGTTGAAGGTTATGGATAAGTTGAAGGGAACTATACCCCATTGAGGCTCAACTTTTAAACTTTCAT
TAAATTTTGGACCTAAATAAACCTTAATTTCCATAGTTTTCGAACTTTCTGTCCCTTTATCATCCCTAAC
CGTTAGTGTCACGTTATAGGTTCCCGGCTCTCTAAATACATAACTTACCTTATCCCCCACAAAGCTCTCG
TTTCCAATCTTCCAAGTGTAAGCTATTATACTACCATCGGGATCATAGCTCAGGGATCCGTCTAGTACCA
CAGTTTCATTGGCAATCACAGGCTCTTTTACATATATCCTTGGAATTGGGGGTTGATTCGACTTGAGTAT
GTAAAACTCTGGAGTTCCCAAGTCAAGGACATGAAGCGTGCCATTTTCCATCCATTGATCCATCGGATTC
TTCCCGTCACTCCTTACAACGCTACCCTTAAAGGGAACCGTGAAGTAAACCCAGAAAGGAGTTTTCATCT
CTGGAATTATCTTTCTCATGCTCCCCTCCTCAACTTCCGTGAAATTCAGCAAGAGTACGTTGTAGTCAAA
TCCCCGGGAGTCTATTATCTTCTCAGGCTTTCCATCCCCATCATCATCAACTAAAAAGTCAAGCATCCCA
TCGTCATTCTCCGTGTTATTAAACGCCCTAATTAGGAAGTGCGTTCTAACTTCTTTAATCAACGAAGTTT
CGTTTCCTCCTAGTTCATCGCTGTGCTTAAATGTTGCATTATACTGAAGGAACTTTCCACTGACTTCAGC
GATCATGAGCCATGCGGCCGTTGAACTCTCTCCTGGGTTCAAGTCCCCAAAGTCTATTGTCAGGCTATTT
GGAACTTTTTTACCATTTACTAGCGTCCCTATTATCTTAAAGTCTATGTACACTCCAGGATAGTTAGATC
TCTCAATTTTAGGCTGAGCTGAGGCTATACGCAATTTCCTTGCAGTTCCATATCCCACGTTCTTAACCCT
AACCCCGAAGATGAAAGGTATTGGAAGTTCCTTCTCAGGGGTGTAGGGATCATCTCCAAACACATAGGAG
GGGAGAACGTAGTCTAAGACAAGCTGTGGAACAGGTTCCACCTCTATCATAGCGGGCCAGGTCTCGTAAA
CTAACTTCGTACTTCCCACTCTAGCTGTTATATTAGCCATAACATAGTACCGCGCTCTGAACTTCTCAGC
TGCTCCAACCTTTGGAATAATAAGCCACTTCATCTCGGCCGTTTTCTCTGGCTCCAGGGAACTTCCACTT
AATCCAGCCTTTTCATCTAACCGTACAAAGAACTTGTCGTCTACTCTATTGCCTTCTTCATCGAAGAATA
TTACTCTTACACTAACGTTCTCTAAACTATAATTCCTGTTAGTGTTTGTGAACTTCAATGAAGCTCTAAA
CGCTTGCCTCTCAAAGGTTAACCTCTGCTCTATCGTTAGAACGAGATCAACACACATGTGAAGCGTATTG
CTCGGTTCCTCTTCATCATGAGTTTCAGATTCTCTAAATAACCTACAAACCCTTTCTTTAACTACATCCT
CTGAGGAACAAGTGCTACAGCTCATGGAGGTGCTGGACTTCTTAACTGTGGGTAGACCACCACAAGTAAA
CCTTCCAACGGCCGTTCCACCGTCCCCTCCACCTGCAAGTCCACTTGGTATCATAGAAGGATATCCTCCT
AGGGAACCACTTGCAATAATTTGAATTGGCCTAATTTCCTCCCCCTCAGGTAGGGTACAATCGTTGCGCA
TTAGACAGATCGCACAGTTCAAAAACAGCTGAGCTATGTATGGAGGAAGGTCCTCAGCCGCTTTGTCCAA
AAGCTGGAGCAAACCTACACCACTTGCAATCCCTCCAAGGGCTCCTCCCATCTTGGACATCACATTTAAA
ACTATGCCATTTGCGATATTCACAGCCTTCTTATAGTCAACTTTAAGCTGTCCATTTTCTATCTTTCCAA
CGCCCATTCCGAGAGCGTAAACTGGAGTAGCCGTTCTGCTAACTGCAAATCCGGCTATGTCCCCTTTTGG
AGTCTTTATGAGGGTTAGCTGTAACGAGTTTATTTCTTGGTAAGCTACCGGATCAAACATGAAGAGCGAA
GCCAAATTAGCCTTAACGGAGTTGAAGGTCTTCACGTAGTTCTCCATGTTCTCCTTAGTTGGGTTAGCTT
TATAGGCATTATACGCATCGAAGAGCGATTCAAGATTGTTAAGAGCCTCTCCAGCCAAAGTTGAGAGAAC
TCCCGTATCGTCAATGTTACCGAGGGCTTGTCCAACCTTTTGGGCTATAGCCATAAAGGCTAATTTTCCA
GCAACCGGAAATACGCTCTCCCAACAGCCCTTGCACGTGGGCTTTACGACTATCTGATGGATCCTCTGGG
CTTTGAGCGTTATTTTCCCGGCTTCTTCAACGCAAACCACGCCGGCCTTAAGCTTGAAAACCTTAGTTTC
GTGAAGGCATGGATTTATAGGTGGTGAACGGGAATAGTAAATTCTAACGACATAGGGAACTATCACGGCT
TCTCCTGGCTTCAACTCATCTATCCTGTTAATACCAAACTCAACGTCAATATAGTGACTCCCACCGCTCT
CGAAAGTTACATTGTAGACGGAGATGTATTGATGCGTGTTCCTCACGATAACCTGCCCTCTAAACTCTAG
CATCCCTTCTTCAGCTAGCTTTTCGTAGTCTACGTATACCTCAAGGTCTCCCCCTTCCATCCTTATTTCA
GGGGCCGGAACGTGAGTTGAGTACCACATCTCATGCTTTATTATGTACACATCCTGAATGGTTACCGGAA
CTACCTCCCACTCAACCTCAAGAATTGAAGGTGTTAGAATAATGGAGACGTTCTTCTCAACACCGACCTC
TATGGTTATTGAAGTACTATATCCGTAGTACCCTTCAAGAGAAGCGAAGAGCTTATATTCACCTATAGGA
ACATTTTCAACTTCGAGGGTGCCATTTTTGTTAGTGTATCCTTCAAAGTGGAAGTATCCGTTGTAAAGTG
TCAGCTTGACGTTTTCTAACCTCGTTGCATTGGGATCCATTACAGTTACCTTAACGCCTCCCGTCGCATT
TGGGGTAACCCTAATTCTCATTGGGACTTTTATTGGGTTATAGTTCGAGGAAGATATCGTTATCTCACCT
TTAAAGGTTCCAGTAACGTTCCTAGGTGGCTCTATGTAAAGGGAAATGCTCTCATTATCTTTTGGATCAA
CCTCTGTGAAGTTTGACACTACCTTAACCCAGGGGATTGAAGATCTAATGCTAACGTTTCTTAATGCAGT
GAATCCTAAGTTTCTAACAACTACCTCCGCACTCGCAGTTTCGTTTGTGAGAACTCCAACATCCAGGAAG
TTAGGAGATGTAACTATAGCTGGGGCTGGAGGAAGGACTTTCAACTTTAAGGTTAAGCTCCTAGTGATGT
TCAATCCAAGTTGCCTTGCTTTGAACGTTATCATGATGCTCCCGTTTACAGCGTTCTTACTTGATAGCCC
AATGTTTATAATATTACTTCCTGGTTTAAGATGAAGAACTTTGGGAATTGAAACCTCATATTCTGGAGGG
GCCTTAACGCTGACCGAAACGTCGGAAGCCCTCCAATAGTTTATCAATCTAACCCTCACGGTTCCATTAA
ACTCAACTGGAACGGTGAGGAGGTACAAGCTTGGAATTACTTCGATTCCTACAACATCAAATTCAGCATC
CCTCTCAAGTAGCTCAATCTTTGGATGAGTTGCACTGACTATGAAGTGACCTGACTCCCCCTTAAAGGGC
CTAAAGGTTAAGTTGAAATACCCATTCTCATTCGTCGTAACTATGTACTCCCTAACGAACCCTCCTCTTG
CTATTGATACCTTCACTGGAACGTTTGATAGCATCCCGCTCTCGTTGTAAGCTACCCCCGTAATAAGGAT
CTCCTTTCCAACCTCATAAACGCTACTAACGCTAACATCGGCATTGTATTCAGGTTGCTCAGCAGTTAGC
GTTAAGCTTTTCCTAAATTTGCCCACATCAGTGTTAACCGTAGCATTTATCTCAACGTTTTCCTCAGAGA
TTAAATACTCAAAAGATTCCTCAACTGAGAGATTTGGAGGGAGTTCTATGGATAATCTTTTGCTCATTCC
GTTTAGCTCTATGCTCTTAACGAAAATAGGAGCAGAACCAATGTTCCTGAACGAAACGTAGATTTTCGCC
TTTCCTCCCTTGATGAAGTTCTCTGTGGATATAGTTATTGGATTAAGCACAGACTCGCTTACATTAACGA
TTTTTCTTACCTCAACATCTGCTATCCTAAAGGTTAAATTATAGCTTCCCTTCTTGGGAGGAACTATTTT
ATATCTAAGTACGGTTTTCTTCCCAGGAGGTATTGTTAATGGAGCTTCTATTAGCTCTCCTGAGGAATTA
TCCAGCTTCATTAATGTTTCTGAGGTGTTAAGCTCCACAATTCCACAGTTCCTAATCTCGACCTCGACTA
AACCAGGGAATCCTGCAAGTAGTTTACCTACCCTTATTTCTGGGTTTTCTCCCTCTCTAACCTTGGCGCG
GTGAATAATCCTAGCGGTTGAGTTTCCTACCTTTAGCTCTCCCCTAATTAGAGTTAGTCCTCTCGGCACC
ATGAACACGAATTCATGGCTTGATCTTCCTCTAGGAACTTCAACTTTCCTACTAAGCTTTTCAATCTCAT
TTCCGAATTCGTCTATAAGGATTATAGACAACGTTCCGTTAGCTTCTCCGTCTAAGTTTTCCACCTTGAC
TTTTACAGCTCCTGGGTAGCCTGCGGTTAGGTTTTCCTCATCAACCTCAAGCTTAACTGGAAAGACTTCC
GTCTTCTCACTTTCGAATCCAGAGAAATCGATGGCCGAGATGCTGTAGTTTAGGGTTCCTGAATAAATAT
CTCTAAAGTTAGGTTTTTCAATTGGGACTTCATTTAACCTTTTGCCATCTTTATAAATGAAGTAACCCGC
GACGTCAGAGTCTGGACTTGGGAGCCAACTAAGTTCAACGTAACTCCCGTTTAGCATCAACGTAACCCCG
GATGGTGGAGAGGGAACACCATTTACAGTGAATCTAATGATTTTCTCGGCCAAGTTACCGGCTTTATCCT
TGGCAGTCACGTTTAACGTGTATGTCCCATCTAATTTTATAGGCCCACTGAACTCCCTTCCGTTAACCTT
TACCTTATACCAGTCAAGATTATCGTCGATTACCTGGACTCCAGGAACTACGGTTCCGTTGTAGAGAGTT
CCATCTGTTAAGTTACATACTATCCTGGGGGGCTCCCTATCCAGCGTGAAGTTCCAGCTGTAAGTTATCT
CGTTACCGGCCCTATCTACGGCCTTAACAGTCACGGTATACTTTCCATCTAGGAGGGGTGTTGAATTCTG
GAAGATTAGCCATCCTCCTGAGAATTTTGTACTCCCAGGAACAGACGTTCCTTCGCGATAAACCTCGATC
TCTCCAAACTTAACTCCCGAACCCTCATCTCTCAGATAAGCCCCTATATAGGGTTTGTTCGTAAACGTTC
CATTTTCTGGATAGGTTAACTTTAGAACTGGGGGTTCTTCATCCTCTATAAATACTTTTACCATTCCTTC
GTTGTTGCTTTCGTTTTCCTCGTATACTTCATCATACGGGTCCACAATGGCCCTAAGAGCGTACTCCCCA
TAACTAGCCCTCCACTTAAATTCCAGGGTTATGCTTTCTCCCTTGTCTATCTTAGTTACCCTGTTTATAC
CTACAAAAGAGCTGTTAGCATAGAGAACAATGTAGAAGGGTAACTTACTAGATTCGCCAATATTCTTCAC
GGTTACCTTGATAATAATCTCCTCCCCAGCTACCTCCTTTCCAGAGTGGGTAATGTTTTCAACAGTAAGA
TCTGGGGATGGGACGCTAACTTCAATATCCAGCTTATTGTTCTCCTCATCCCACTCCCTTACAGAATTAT
ACGGATCCGCGATCACGCTCACGTTGTAATCTCCAGAGTCAACGAGCCAGGGAACATTAACTTCAATTTC
TTCCCCAGGAGTGATGCTATCTACGTAAGCGCTCCCAAGTTTTCTTCTCTTGTTCCTGATCAAAAGGTAA
ACGCCGGACTTATAGTCCCCAGAGTTCCGAATTCTAACTTTTGCATTGACCATTTCACCCGGGTAAGTAA
AGTTCCCAAGGTCTGCACTAACTACTACTATGTCGGGGGCCTTTACGTAAGATCTAACTGAGATCTCGTT
ATTATCTTCGTTAAGCTCAACTACGGCATTTGTTGGATCAACAACCACCTTAAACGTCGAGTTTCCTGGG
TAAGGTCTTATCGTTAGCGTTACCTCTTTTACTTCTCCCGAAGCTAGGGAATAAACAGGAGCGCTTCCCA
AAAGTTTTCCATCCTGATAAAGGGAAACGTAAAATATCCTCTTTACATCCTGTCCTCCAGAGTTCTTTAT
GGTAGCATTAACTTTAAAGTAGCTGTTTGCATGCATACTTGGAATGTTCAAGCTCAAAACCTCGATGTCC
GGGAGTACTATTGTTACGTTCTCGACTATTGCATTGTTATCCTCGTTAGACTCTGGTATGTAGTCCTGGG
GATCCACAACAATCCTAACCTCTTTTCTTCCCCCACTGCTAAACCGCCACCTTAAAGTTCTCTCAGCGGT
TTCTCCGTGTAGGAGCTTGTTTATCCAAACAGATGACTTGGGCTCACCATCAACGAACATTTGAACATAG
AATCCCCTGTAGACGTCTCCTCCTGTATTGGTAACGTTAACTTTATATGCCAGGTATCCTCTCCTAACCT
CTTCCTCGAGCCATTCATATCCACTTAACATAAGCTCGGGCGATTCAACGTAATAAGTCCTTTCTATTAT
GTTGTTACTCTCGTTACCTTCTACAATCCTGTTTCCAGGATCGACCTCTACCTTAACTCTGACCTCACCC
ACCCTATCAACGTACCAGGGTAAGGTCACACTCTTACTTTCGTTCTCCTTTATTCCATATACCGTCCTAT
AGTACCTCTCCCCACTTACATTAAAGAGAACCGTTATTGGCCTGTATATGGAATCCCCTAGGTTCTTAAC
CGTGGCATTTATCCTAACAAACTTTCCATAGGCTAGATCCTCTACACTCAAGTTTTCCAACTTAAAATCA
GGAGTTCCTACGTTCCCTAAGAAAGCTGAGAATTCGTTATTGCTCTCATTACCTTCAGGGATGCTATTAT
AGTAATCCACAACTATCTTCACCGTTAAGTTCCCGGGCTTGGCGTTATACCACCTCCAATTGAATTCCTT
GGTTTCTCCTTTCCCAAAACTCCAGTTCCTAGGATACGCGTTCGTTGAGTATATTTTCCTCGTACCGTTC
CAGATCTCAGCCCTAACGGTAAAGCTCTTAAGAAACGGCTGTCCGAGGTTTTTAACGTAGATTGTAAATA
GCACATTCTCACCAGAGGTGAAGTTATAGGGAGCCCAAGTAATCCCCTCAACTTTAAGATCCGGTTTCCC
AAAGCTTAAGCTGAACGTCAAGTTATTGTTCTCTTCATTTTCCTCTATCCACCTATTGTAAGGATCTAAA
ACTATGCTTAAGTTGTGCTTTCCTGAGGAAGGTAGATAGCGGAGGGTAACATCCCTAGAAGCTCCGCTCT
CAAGTCCATAAACTGAAGTAGAGGTTTTAATAATTCCATTATCAAAGAGATCAACCCTGATACCATCACT
AAAGTTTCCTCCCAGGTTTGAGATGTTTAAAACTATTGGATAGGCCTTGTAGAGGTAGGCTGTTCCATTG
AGAATCTCATCTGGAATTGAGTAGTTCAATATAGCAAAGTCTGGCTTCTCTAGCGTTAGGATGAGGGTAT
CGTTGTTGTTCTCGTAGATATTTTCGTACTCATCTACTATCCTTCCCATTATCTTATTCGTTCCACCGTT
TAAGGTAATCCATACAACTTGGGAAATGTTAGCTCCTGGGGAAAGCGTTGCAGGGGCCAGTTCGTACCTT
CCCAGGGTATGGGTTTTCCCATTTTCATCTTCAAGGGTTACGTAAAGACCTAAATATGGGCTATACCAGC
TACTTCTGTCTATCCTTAGCGTTGCATTACCGACGTTCTTCACTAAGAACGTTATCTTAACGTCTTTCCC
TGCCGAGAGTTCTCCACTGGGTGGGATTATACCCAATTCGAGGTCAGGATAACCCGTCGTATAGTTGATT
ATAAGGGAGTTATCCGAGTACGATGTCTCATTAACTTTCATGTTATAGTTTACCGTTACGTTTATCGTTG
AACCTGGGGGAAGCATGGCCAGGGAATCAATTGAGATCGTGTAATTATCACGTATTATCCCCCTTAGATA
AGACACCTTCCATCCATATTCAGTTTTGATCTTCACGGGTACTTGATAAGAGGTTGCATTGTAAGGAGCC
CCCACATTCCCTATGGTAATGTTTAGTGGGATGTAACCGACTGTGTTATTGGGTAGGGAGATTTCTTTCA
CAACGAAGTTAGGCTTTGGAATATAGCCCATATTATAAAAGATCACGTTATTTCCCTCATTTGTCTCGGA
AATCACGTTATGTGGATCAACAACAAAAATCAACGTGGAGTTCCCACCGTTTATGGGGAGGCTTATTATC
GTCCATTTTTCTTCCCCGGATTTTATACCTCTCAAATAAGCAATACTACTCCTCAAGCCACCGTAAACGG
CTATTGAGAAATATCCAGAATAATCCTCTCCCTCATTCTTAACGGTCACATTGAACTTTGCTTTACTACC
AGCAATCCCATCGAAACTTAGAAGTTCAACTTTTGAAATTTTGAAGTCGGGTGCATTGACAAAGATCAAC
CTAGAGAGCCTATTGTTACCTTCATTTATCTCGTCTACGTAGGAATATGGGTCTACGACAACGGTTAGGT
TAACGAGGCCAGCATTACCAGGTTTCCAAGTTAACGTCACATTCGTTTCATTGTTGATCCTAACCCTTCT
CCAGTCCTTGGATGTTCCATTTTCGTAAAGCTTAACTAGGACGTTTCTACCGTAGCAACCCCCTAGATTA
TCTAAGGTAACATTGACTTCGTATAGATTGCCGATACTCACATTCCCTGGGATGTTCAGCGATTTAACAG
TAAAGTCGGGTTTTTCTATGATGATGTGGTATGGAACTTCAACCTTGTTGTCGCTCTCATTACTTTCCTC
AACTTCGTTCCATGGATCAATCTCAATAACTACTTTTTCGAGGGTTCCTGCCTTGATCATAGGGGTAAAA
ATAACCTCACTCTCCTCCTCACCCTTAGTTGATATATACCGGGTATATGACCGATTACCTTCCTCATAAA
CGAGGGTTAGCCTAACGGGGATACTCCAGTTTGCGGTGCTAGTAACGTTAACTCTAACTTCCCCTGTAGA
GTCCACACAAGTCGGTAGGTCAATGGAATAGTTTCCTACCTCGAAGTTGGGTAGAGGGAAATTGTAGTTC
CCTAGGAGGTAAATGTTATTGCTACTATTTATATCCCCTTTACCCTCAACTAGGAGTGCCAAAGTATAGT
TTCCTCCCTGAACTAACCATGAGATTTCTCCTTCAGCGATCCCATTATAAAAGCTTAGATACTCTATCTT
CTCTTCAACTCCATTGCGAAGTAGTTTTACCTTTGCAGAGGGAATTTTTGACGTGGTTCTTACCTTAAAA
TTTATGGAAGCAAATTCTCCTGGGATTAAATTATTAATGGAGGCGTTTTCTACCCAATAATCTCCGGGCC
AAACCCCTACTTCAGCTAAATTGTTAGAAAGATCGGGGTCATCCATGCAGTTGGCAAAAACCTCAACGTG
ATAATTGGACAGGGGAAGCGTTAGAAGATAGCTTCCGCTCTCACGAACTTGATAAGTATAGAGCTTTGGG
GTTCCCAATGGAACTTGGATTGCAAAGCTCTTTCCCTCTCCCTTTGTAAACCCCTTAACATCACCTGAAA
CCTTAGAATAATAACCAGAGAACAGATCATAGTCATGATAAGAATACTCTAGAGATTTGTAGCTCCAGGT
TATAGTTCCGTTAGAGTTTATTATGACTTGAAAGTTTATATTATCTACAATTTCACTCTCATAATCTTCA
TATGTTGATGCCAGCCACTCGATCACGATCTTGTCTTGAAGGTTAACTAGGAGGAGGTAACCATCATATG
TCACGAGATCCTCATCGAGTCCAAAGATCACGTCACTCTCGTAAAATTCTCCCTCTTCATGTATTCCGTA
GTAATCCTCAATTCTTGGCTCCTCATACTCCTCAAGAAGCTCAATCAGGCCGTTAGTATTTACAGCTATC
TTCTTTATCTCCCTCCCAAAGTAGTTAAGCGAGAATGGAAGCTCATAAATGAAGTAGCCATCATCCTCCC
TCATTATAACGTTTCCATCTCTAAGGTATTCTCCGTAGGTTGCCTCAGTTGCACTTTCAATGTACTCACT
TAAGTTCATCCATGTAAATGAGATCTCACTAACATTTGGGGCCTCGATAGGGGAGAAAACTGAAAACGTT
AGGTTACAAGACCCAGCATCATATAGCGTTGCGTTGATAACTACACTGTCTCCAGCGAGATAATAGTCAG
CAAATACTTTAGTATCTTTACTACCTTCCCCTAGCGCCCAAGGTGGTATTAAAGAAATAAAAAGGATGAG
CGTTAAGATTAACCCC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 12336 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/AY78Edfitg/repfind.fasta
19   316 R 19   316  0 1.56e-04 aagatgttgtgttgtagaa
22   281 F 22  1388 -2 5.06e-03 aacccag[ac]cctcaaagtct[tc]tc
24    83 R 24  4775 -3 8.31e-03 ttgggtta[at][ct]ttcagggttac[ct]ct
23  5703 F 23  8745 -3 2.91e-02 ttaaccgt[ag]gcatttatc[tc][ct]aac
15  1452 P 15  8695  0 3.99e-02 ttctctttaatgtaa
15  1578 R 15  1578  0 3.99e-02 accttccaccttcca
15 11580 R 15 11580  0 3.99e-02 tttccctctcccttt
15 11918 R 15 11918  0 3.99e-02 ctcctcatactcctc
20  1073 R 20  1073 -2 6.66e-02 ggttctaa[cg]tt[gc]aatcttgg
22    70 F 22  5187 -3 1.01e-01 ataatat[gt]acttc[tc]tgg[gt]ttaa
14  1345 P 14  1345  0 1.59e-01 taaagttaacttta
14  1686 R 14  2675  0 1.59e-01 ttgaaggttatgga
14  1816 C 14  1967  0 1.59e-01 taaccgttagtgtc
19  4621 F 19  9679 -2 2.40e-01 cattttca[at]cttc[ga]agggt
21    84 P 21  2132 -3 3.49e-01 tgggtt[at]acttca[gc]ggtt[ac]cc
21  1343 P 21  3596 -3 3.49e-01 cttaaagtt[ag]act[ta]ta[ga]gaag
21  4330 F 21  5984 -3 3.49e-01 taaa[ct]t[ca]tagc[at]tcccttctt
21  5562 F 21  7641 -3 3.49e-01 atc[ca]cgctc[ta]cgttgtaa[gt]ct
21  8540 F 21  8855 -3 3.49e-01 gtt[ga]tt[ag]ctctc[ga]ttaccttc
21  8855 F 21 10826 -3 3.49e-01 gtt[ag]t[tc]gctctcattac[ct]ttc
16   293 C 16   299 -1 4.78e-01 aaagtc[tc]ttcaggaag
16  3354 P 16 11123 -1 4.78e-01 cctcctagggaac[ct]ac
16  5393 F 16 11930 -1 4.78e-01 ctcaag[ta]agctcaatc
16  7593 F 16  9192 -1 4.78e-01 ttattgttctc[ct]tcat
16  8197 R 16  8215 -1 4.78e-01 ctattgttacgtt[ca]tc
13  1025 F 13 11087  0 6.38e-01 atagtttcctacc
13  1457 R 13  1457  0 6.38e-01 tttaatgtaattt
13  4588 R 13  4588  0 6.38e-01 gagaagcgaagag
13  4865 R 13  4865  0 6.38e-01 gtaaagggaaatg
13  7277 R 13  7277  0 6.38e-01 ttcgttgttgctt
13  9712 P 13 10171  0 6.38e-01 aatatgggctata
18   759 F 18  3185 -2 8.58e-01 aaataa[gc]ctacaa[ca]ccct
18  1239 R 18  4521 -2 8.58e-01 ac[ct]cttcttgca[tg]aggta
18  1545 F 18  4392 -2 8.58e-01 ccttcc[ta]tccttat[ct]tca
18  3198 R 18  7689 -2 8.58e-01 accc[tc]ttctttaact[at]ca
18  3343 P 18  3343 -2 8.58e-01 tag[ag]aggatatcct[ct]cta
18  5074 R 18  5074 -2 8.58e-01 gga[ca]tttcaacttt[ac]agg
18  5079 C 18  5469 -2 8.58e-01 ttcaacttta[at]gg[tg]taag
20  2129 C 20  6595 -3 1.20e+00 aaag[gt][gt]aacc[gc]tgaagtaaa
20  2251 R 20  9541 -3 1.20e+00 ctat[tc]atct[ta]ctca[gt]gcttt
20  7481 F 20 10394 -3 1.20e+00 attctt[ca]acggt[tc]ac[ca]ttga
20  7589 F 20  9188 -3 1.20e+00 ca[ga][cg]ttattgttctc[ct]tcat
20  7739 R 20  9190 -3 1.20e+00 ttt[ta]cttctcttgtt[ca][ct]tga
20  7913 F 20 10658 -3 1.20e+00 at[ct]ttcgt[ta]aagct[ct]aacta
20  8661 P 20  8714 -3 1.20e+00 attccatatac[ca]g[tg]cc[ta]ata
20  8871 F 20 11229 -3 1.20e+00 ccttcag[gc]gat[gc]c[tc]attata
15    88 R 15  6600 -1 1.79e+00 tt[at]acttcagggtta
15   201 F 15  1311 -1 1.79e+00 aagctccagttt[tc]ct
15  1023 F 15 11193 -1 1.79e+00 gtatagtttcct[ac]cc
15  1190 R 15  7804 -1 1.79e+00 agttacgttt[at]caat