Ori-Finder 2 Result - jobID: HrWjqRGOhB (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Archaeoglobus fulgidus DSM 4304, complete genome.
Chromosome size2178400 nt
Chromosome GC Level48.58%
The location of oriCs with ORB sequence782672..785539;
The location of DNA replication genes219696..220925; 627965..629095;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 782672..785539
The size of oriC2868 nt
The GC Level of oriC42.64%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common652671--16.17828.46e-05ACCCCTATACTTCCTCTCAG
Common11801199+-16.73599.42e-05AAGCCATCATTGTCTCTGCA
Common13221341--6.474161.12e-05ACTCCTTCATTTCCTCAGAG
The sequence of oriC
TTTCTCCTATTTTTAAGCTAATTTATCAAACAAAATCGTTAAATATTTTCTCCACAATACTCACTATAAT
GAACTTAATCATTTCAAACGAGGAATCGCATTACCTTCCGGGCTGGAAAATAATTCTGAGCATGGAGGAA
TTCAGCAAAGTTCTGCATTTCAGCATAGAAGAGGCTAAAATCAACCTTGAAATCGACTGGGCTGAAGCTG
CTGAACTGAGTGCTGAGATAAAGAGGAAAAATCCTGCTTGCAAAGTCGAGTTCTTTGAGTCAGATAAGGG
CGAGTTTTCCTTTCTTAAAAGTTTTCTTGAGAGAATAAAGTATCCTGCAGTGATCGGAAGGTTTGTGGGT
GAAGAACCCGTAATTGTCTACGCCAATCAGTCCTTTGTAGACTTGTTCGTCAATAATGGAAGTTTTATTG
TGGGCGATTACCTCGATAAACTTGTTGTACCACCTGAGAATCATGAAGAGGCCTTAGATTTGAACAGAAG
AGTTAAAGAGGGTGAAGTGGTGTTTGTTGAGGTTAAGAGAGCTACAAAGACTGGAGAGAGATATTTTGAG
CTAACCGCCCTCCCCTTTTCCAGAAAGTATGCAGTTGCTATTTACAGAGACATCACAAAGAGAAGAGAGG
CCATGCAGAAAATAGTTGAGTCTGAGAGGAAGTATAGGGGTGTTTTCGACACATCCTTCGAGCCCATGGT
CCTTCTCGATGGTAGTTTCAGCATTATTGAGGTCAATAAGGCTTTTGAAGAGGAGTTTGGTGTAAGTGGT
GAAGAGCTTAAAGGGAAAAATATACGGGAAATTCTGGATATCGACCCCTCACTTGAAGAATCCGAGATTG
AAGCTTTGGTCGGGGGAAGAAGAAAAATAATGGTTTATCGAATAAAAAAGATTAACTCTGAGATTCTGCT
CAGCATTAAAGACATTACTGAGTTTGAGGCAACAAGCAGACTGCTCAGGGCAATTACCTACGCCAACGAC
CTTATTGTCAGAGTGGATGACAGAGAGGAGCTTTTTGAGCAATCCGTTAAGCTTCTGGCCGACATAGGCA
AGGAAAGCTCCTGCTGGATAGGCATGCTTTCAAATGGAGAAATAACAAAGGTTTACTGCGAGGGTTGCTG
CTGTGCAGTTGAGATTACAACTTATCCAAAATGCTTTGAGGAGGTTCTCAGGAAGAAGAAAGCCATCATT
GTCTCTGCAGAGGATAGAGACGAGGACTGCCCCTTTTACACCAAGAAGCCAAGGCTTTGCTGCATCATTG
CTCCTCTCATAATAAACGGTGATGTGATAGGCTTTAACGTTCTGCACTCTCCAACTGAGTTCTCTGAGGA
AATGAAGGAGTTTTTTGAGTCCGTAACCAACAACATAGCAATAAAGGCCAAAGCAATTGAAGCCGATAAA
GCTAAGAAAATTGCCTTCAAGCAAATTGAGGACAACATCATCAAGCTTGCGGGGAATCAACAATGAAGCA
GGATGAGCAGGAGATTGAGTGGTATAAGGCATTGGTGGATAATTCGTCCGAAATACTGATGATCATCGAC
GAATATGGAAACATAAAGTACATTTCTCCTTCTGTGAAGGATATTGCGGGATATGACAGTGATTCGCTCA
TAGGAGTTAATACCTTCATTTTTGCCCATCCCGACGAGGTTGACTACATATTTTCCAAACTTCAGTTTTT
GCTCGAAAACCCAGGAGTTCCAGAGTTCATCGAGTTCAGGGCTTTGCATAAAGACGGGCACTGGGTGGAA
GTGGAAGCAATGGGCAAAAACCTCCTTCACACGCCAGTTAAGGGAATTGTAGTTACAATGAGGGACGTGA
GCAAAATCAAAAAGCTCGAAAAAGAGCTTAGAAGGCTGGCAGAGAACGTTCCCTTTGGAATTATTGTTTT
GGGTGATGGTGGGATTATATACTCCAACAAAGAGGCCGAAAGGATTCTCGGATATAGCAGGGAAGATTTT
CCGTCTTTGGAGGAAATCTCATCCAAAATTGAAGGAGAGAAAGGCAGCTTCATTTCAAAGATGAAGAGAA
AGGATGGTAAGGAAATCTGGCTCAGTGTGAGATACATTGAGACGGAGTGGATGGGAGAGAAAGCCTACCT
TGTAGCCTTCTCAGACATAACCGAAAACCTGTTACTCCAGAAAAGGCTTGAGAGCAGAACAACACTCCTC
AAAACCATCAACAGAATTCTCCGCCACGATTTGATAAACGACTTAACTGCAGCCCTTGGAATGCTTGAAG
TTTACAGGGATTTAAGGGAGGAGAGCCTTCTTTCTACAGTTGAAAGAAGATTGAATGATGCTGTAAAGCT
GATAAAGAGGATGAGAGAGCTTGAAGTTCTCTCTGAAGATGGAAAGGAGCTGAAGGAGATTAGAATCTCC
GAAATTGTTGGGGAATTGAGGGGAAAATACGACATTCAGATATCACTTCAGGGAGATGCTGTGGTGGAGG
CTGATGATGCCCTTTTCTCTGTTTTCGACAACCTGATAAGAAATGCTGTCGTCCACGGAAACGCCTCCCT
TGTTGAGATTAAATGCACTCAGAAAGATGGACTTTGCGAGATAGTGGTTGAGGACGACGGCTCTGGAATT
CCTGAGGACAAGCTGCAGAAGGTGTTTGAGAGAGGTGTAAAATTCGGAAAGGGTGGGGCGATGGGTCTGG
GGCTGTTCTTGGTTAAAAAGCTAATTGAAAGGTATGGTGGTAATGTCAGGGCTGAGCCCTCCTCCAAGGG
TGCAAGGTTCGTTATACAGCTTAGGGGTAGAGTTACTTAATCTGAAAGTAATTGCAATTTTGAGCAAAAA
ATTTATTAATGATTTTTTGGTTAAATTAGATTGGAGGTGATAGCCAAGAGGGGGAAGAAGAGCAGAGG
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 2868 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/HrWjqRGOhB/repfind.fasta
23 2266 P 23 2266 -3 1.57e-03 cttctttc[ta]ac[at]gt[ta]gaaagaag
15 1828 R 15 1828  0 2.15e-03 aaaaagctcgaaaaa
21 2322 P 21 2322 -3 1.89e-02 gagaga[ga]ctt[gc]aag[tc]tctctc
13 1786 R 13 1786  0 3.45e-02 gttaagggaattg
20  719 P 20  723 -3 6.48e-02 agc[ac]ttattga[gc][gc]tcaataa
15 1332 P 15 1764 -1 9.70e-02 tgaaggag[tg]tttttg
15 1762 C 15 1960 -1 9.70e-02 ggca[ag]aaacctcctt
12  851 F 12 2849  0 1.38e-01 gggggaagaaga
12 1337 R 12 1337  0 1.38e-01 gagttttttgag
17  396 C 17 1611 -2 1.65e-01 tc[gc]tcaat[at]atggaagt
17 1314 R 17 1334 -2 1.65e-01 ctgagtt[ct]t[ct]tgaggaa
17 1324 R 17 1324 -2 1.65e-01 tgaggaa[ag]t[ga]aaggagt
19 1076 P 19 2267 -3 2.20e-01 ctttcaa[ac]tg[gt]agaaa[tg]aa
19 1330 R 19 1337 -3 2.20e-01 aatg[ac][ac][gt]gagttttttgag
19 1758 C 19 1956 -3 2.20e-01 aa[ta][ga]ggca[ag]aaacctcctt
14  257 F 14 1337 -1 3.62e-01 gagtt[ct]tttgagtc
14  399 C 14 1614 -1 3.62e-01 tcaat[at]atggaagt
14 1005 F 14 1335 -1 3.62e-01 aggag[ct]tttttgag
14 1691 P 14 2580 -1 3.62e-01 cagga[ga]ttccagag
11  138 R 11 2205  0 5.52e-01 aattcagcaaa
11  226 F 11 2310  0 5.52e-01 gataaagagga
11  602 R 11  602  0 5.52e-01 tacagagacat
11  670 F 11 2469  0 5.52e-01 tgttttcgaca
11  854 F 11 1170  0 5.52e-01 ggaagaagaaa
11 1007 P 11 1826  0 5.52e-01 gagctttttga
11 1628 P 11 1759  0 5.52e-01 tttttgcccat
16  430 C 16 1006 -2 5.82e-01 cctcga[ta]aaact[tc]gtt
16  655 R 16 1324 -2 5.82e-01 gaggaagta[ta]agg[ga]gt
16  990 F 16 2074 -2 5.82e-01 gagtggatg[ag][cg]agaga
16 1243 P 16 2293 -2 5.82e-01 gcttt[ga]c[ta]gcatcatt
16 2159 R 16 2159 -2 5.82e-01 caa[ca]actcctca[ac]aac
16 2364 P 16 2364 -2 5.82e-01 ggagatt[ac][gt]aatctcc
16 2580 P 16 2580 -2 5.82e-01 ctc[ta]ggaattcc[ta]gag
16 2818 R 16 2818 -2 5.82e-01 ggtta[ag]atta[ga]attgg
18  251 R 18 2759 -3 7.42e-01 aaagtc[gt]a[ga]ttc[ta]ttgag
18  632 R 18 2197 -3 7.42e-01 at[gt]cag[ac]aaatagtt[gt]ag
13  227 R 13 1081 -1 1.34e+00 ataaagagg[at]aaa
13  513 F 13 2519 -1 1.34e+00 ttgttgag[ga]ttaa
13 1157 C 13 2718 -1 1.34e+00 gaggaggttc[tc]ca
13 1675 P 13 2787 -1 1.34e+00 tttttgctc[ga]aaa
13 2707 P 13 2707 -1 1.34e+00 agggct[gc]agccct
15    7 R 15  403 -2 2.04e+00 tatttt[tg]aag[cg]taat
15   43 P 15 2394 -2 2.04e+00 tattttc[tc]cc[at]caat
15  233 F 15 1050 -2 2.04e+00 aggaaa[ag][ac]tcctgct
15  299 R 15  544 -2 2.04e+00 agtttt[ca]t[ta]gagaga
15  361 F 15  961 -2 2.04e+00 aatt[ga][tc]ctacgccaa
15  518 F 15 2316 -2 2.04e+00 gagg[ta]t[ag]agagagct
15  635 R 15 2197 -2 2.04e+00 cag[ac]aaatagtt[gt]ag
15  743 R 15  743 -2 2.04e+00 tttga[ag]gag[ga]agttt
15  913 R 15  913 -2 2.04e+00 catta[ac]aga[ca]attac