Ori-Finder 2 Result - jobID: E56pz02P1L (motif: Methanobacteriaceae; motif count: 3; P-value: 1E-04)
Your Query:Methanothermobacter thermautotrophicus str. Delta H chromosome, complete genome.
Chromosome size1751377 nt
Chromosome GC Level49.54%
The location of oriCs with ORB sequence1277375..1277679; 1277833..1278179;
The location of DNA replication genes1278180..1279328; 1464633..1465772;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 1277375..1277679
The size of oriC305 nt
The GC Level of oriC40.33%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Methanobacteriaceae322+15.24082.88e-07GAGGTCCGGTTCAACTGTAA
Methanobacteriaceae5372+15.73242.39e-07GGGATGGCTTTCAACTGTAA
Methanobacteriaceae106125+17.60071.16e-07GTCAATGGTTTCAAGTGTAA
Methanobacteriaceae159178+27.63057.06e-10GAGGTCAATTTCAACTGTAA
Methanobacteriaceae210229+27.63057.06e-10GAGGTCAATTTCAACTGTAA
Methanobacteriaceae260279+16.12572.05e-07GACATCAGGTTCAACTGTAA
The sequence of oriC
GGGAGGTCCGGTTCAACTGTAAGGACTCCCTGTAACCATTTTTCTTATGTGGGGGATGGCTTTCAACTGT
AAAATCATTTGGGTTTCCTGTTTCTCTGGGTGTGGGTCAATGGTTTCAAGTGTAAAGTTTTTTCTCTCGT
TTAGTTGCCCGAGTGAGAGAGGTCAATTTCAACTGTAACCAGCGAAACTTTATTCAGGCTTAACAGAGAG
AGGTCAATTTCAACTGTAACTTTATTATTAAAAATTTGTCTAAAATAGTGACATCAGGTTCAACTGTAAA
AGGTTCTTTCCTGGTTCGGCCTGGT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 305 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/E56pz02P1L/repfind.fasta
25 154 F 25 205  0 2.32e-11 gagagaggtcaatttcaactgtaac
16   6 F 16 263 -1 2.92e-04 tc[ca]ggttcaactgtaa
13   9 F 13 266  0 3.90e-04 ggttcaactgtaa
13  61 F 13 268  0 3.90e-04 ttcaactgtaaaa
13  95 R 13  95  0 3.90e-04 ctgggtgtgggtc
18 213 R 18 213 -2 5.24e-04 tcaat[tg]tcaact[gt]taact
20   2 F 20 158 -3 7.32e-04 gaggtc[ca][ga][gt]ttcaactgtaa
20   2 F 20 209 -3 7.32e-04 gaggtc[ca][ga][gt]ttcaactgtaa
20   2 F 20 259 -3 7.32e-04 ga[gc][ga]tc[ca]ggttcaactgtaa
12  60 F 12 166  0 1.56e-03 tttcaactgtaa
12  60 F 12 217  0 1.56e-03 tttcaactgtaa
17 162 R 17 214 -2 1.86e-03 tcaat[tg]tcaact[gt]taac
11  11 F 11  61  0 6.24e-03 ttcaactgtaa
11  11 F 11 167  0 6.24e-03 ttcaactgtaa
11  11 F 11 218  0 6.24e-03 ttcaactgtaa
11 167 F 11 268  0 6.24e-03 ttcaactgtaa
11 218 F 11 268  0 6.24e-03 ttcaactgtaa
16 162 F 16 263 -2 6.58e-03 tca[ag][tg]ttcaactgtaa
16 163 R 16 163 -2 6.58e-03 caat[tg]tcaact[gt]taac
16 213 F 16 263 -2 6.58e-03 tca[ag][tg]ttcaactgtaa
13  60 F 13 113 -1 1.52e-02 tttcaa[cg]tgtaaa
15  74 R 15  74 -2 2.30e-02 tc[ac]tttgggttt[ca]ct
15 240 R 15 240 -2 2.30e-02 aaaat[tc]tgt[ct]taaaa
12 113 F 12 166 -1 5.61e-02 tttcaa[gc]tgtaa
12 113 F 12 217 -1 5.61e-02 tttcaa[gc]tgtaa
12 114 F 12 268 -1 5.61e-02 ttcaa[gc]tgtaaa
14 161 R 14 212 -2 7.98e-02 gtcaa[tc]tt[ct]aactg
14 161 R 14 161 -2 7.98e-02 gtcaa[tc]tt[ct]aactg
14 212 R 14 212 -2 7.98e-02 gtcaa[tc]tt[ct]aactg
14 291 R 14 291 -2 7.98e-02 tggt[tc]cggc[ct]tggt
9  29 F  9 172  0 9.98e-02 ctgtaacca
9 185 F  9 227  0 9.98e-02 aactttatt
9 237 R  9 237  0 9.98e-02 ttaaaaatt
11  11 F 11 114 -1 2.06e-01 ttcaa[cg]tgtaa
11  83 F 11 286 -1 2.06e-01 tttcctg[tg]ttc
11 168 R 11 214 -1 2.06e-01 tcaact[gt]taac
13 129 R 13 129 -2 2.74e-01 ttt[tg]ctctc[gt]ttt
13 281 R 13 281 -2 2.74e-01 ggt[tc]ctttc[ct]tgg
15  30 F 15 120 -3 2.99e-01 tgtaa[ca][cg][at]tttttct
8 122 P  8 184  0 3.99e-01 taaagttt
8 231 R  8 231  0 3.99e-01 ttattatt
10  12 R 10 215 -1 7.49e-01 tcaact[gt]taa
10  12 R 10 164 -1 7.49e-01 tcaact[gt]taa
10  30 P 10 108 -1 7.49e-01 tg[ta]aaccatt
10  62 R 10 215 -1 7.49e-01 tcaact[gt]taa
10  62 R 10 164 -1 7.49e-01 tcaact[gt]taa
10  89 P 10 178 -1 7.49e-01 gtttc[tg]ctgg
10 164 R 10 269 -1 7.49e-01 aat[tg]tcaact
10 215 R 10 269 -1 7.49e-01 aat[tg]tcaact
12  30 P 12 251 -2 9.26e-01 tgt[ac]ac[ct]atttt
OriC: 1277833..1278179
The size of oriC347 nt
The GC Level of oriC36.60%
DoriCORI10010005
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Methanobacteriaceae4665-28.61383.14e-10GGGATGAATTTCAAGTGTAA
Methanobacteriaceae95114-31.6621.97e-11GACATCTATTTCAAGTGTAA
Methanobacteriaceae184203-25.76222.39e-09GTGGTAGATTTCAAGTGTAA
The sequence of oriC
ATCTAGCCATGAATCAGAGAACTGGATAAGGAACAGCAGGATTTTTTACACTTGAAATTCATCCCTCATG
AATTCCCATCGAGGATCCAGATGGTTACACTTGAAATAGATGTCCCACATATATTATTATCGATCAACCT
GATTTTAATAAAAACTTTTATCTAATAGTTGGAATAAGAGAATTTACACTTGAAATCTACCACACCCTCA
AATCAGGGAATGGTAGTACGGGGCGCTGCCAGCTGAAAAGGTCATCCTGATATTGAATTTCACTGTATCC
AGATTTTAGGGCCTTTACTGAAATTTGATGCAGCAGTTTTCTCTAAAAATTTAGTTGAAGTGGTACT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 347 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/E56pz02P1L/repfind.fasta
14  44 F 14 182  0 1.26e-04 tttacacttgaaat
13  45 F 13  94  0 5.05e-04 ttacacttgaaat
13  94 F 13 183  0 5.05e-04 ttacacttgaaat
19  39 F 19 177 -3 3.22e-03 ga[tg][ta][ta]tttacacttgaaat
12 132 C 12 165 -1 7.27e-02 atcaacct[gt]att
14 147 P 14 147 -2 1.03e-01 ataaaa[ag][ct]ttttat
16 193 R 16 196 -3 1.19e-01 aa[ta]ct[ac]ccacacc[ca]tc
9  52 P  9 263  0 1.29e-01 tgaaattca
9 121 R  9 121  0 1.29e-01 tattattat
9 174 R  9 174  0 1.29e-01 taagagaat
11  10 F 11 171 -1 2.66e-01 gaat[ca]agagaa
11 142 P 11 142 -1 2.66e-01 tttta[at]taaaa
13 133 F 13 251 -2 3.54e-01 tca[at]cctgat[ta]tt
13 204 P 13 278 -2 3.54e-01 ccct[ca]aaatc[at]gg
15 155 F 15 316 -3 3.87e-01 tttt[ac]tctaa[ta]a[ga]tt
15 257 P 15 257 -3 3.87e-01 tga[ta]att[gc]aat[ta]tca
8  40 R  8  40  0 5.17e-01 atttttta
8  84 F  8 276  0 5.17e-01 atccagat
8 103 C  8 156  0 5.17e-01 aaatagat
8 137 P  8 209  0 5.17e-01 cctgattt
8 281 R  8 281  0 5.17e-01 gattttag
10  11 F 10 210 -1 9.69e-01 aatcag[ag]gaa
10  20 R 10 244 -1 9.69e-01 actgga[ta]aag
10  51 F 10 262 -1 9.69e-01 ttgaa[at]ttca
10 137 F 10 278 -1 9.69e-01 cc[ta]gatttta
10 175 C 10 318 -1 9.69e-01 aagaga[at]ttt
12  24 R 12  24 -2 1.20e+00 ga[tc]aaggaa[ct]ag
12  49 R 12  49 -2 1.20e+00 actt[ga]aa[ag]ttca
12 142 P 12 142 -2 1.20e+00 tttt[at]at[at]aaaa
12 196 P 12 214 -2 1.20e+00 ctacca[ct][at]ccct
12 322 P 12 322 -2 1.20e+00 ctaaa[at][at]tttag
14  97 P 14 328 -3 1.24e+00 cactt[gc]aa[ac]ta[ga]at
14 142 P 14 314 -3 1.24e+00 tttta[ag][ta][ag]aaaact
14 192 C 14 329 -3 1.24e+00 aaatc[ta]ac[ct][at]cacc
14 206 C 14 281 -3 1.24e+00 ct[ca]aaatc[ac][gc]ggaa
9  15 P  9 313 -1 3.49e+00 aga[ga]aactg
9  19 P  9 275 -1 3.49e+00 a[at]ctggata
9  36 R  9 283 -1 3.49e+00 c[ag]ggatttt
9  39 C  9 322 -1 3.49e+00 gattttt[ta]a
9  52 P  9  52 -1 3.49e+00 tgaa[at]ttca
9  53 P  9  67 -1 3.49e+00 g[ag]aattcat
9 104 P  9 116 -1 3.49e+00 aata[gt]atgt
9 118 C  9 158 -1 3.49e+00 ata[tg]attat
9 137 F  9 255 -1 3.49e+00 cctgat[ta]tt
9 139 R  9 326 -1 3.49e+00 tgattt[ta]aa
9 139 C  9 296 -1 3.49e+00 tga[tc]tttaa
9 148 F  9 323 -1 3.49e+00 taaaaa[ct]tt
9 150 P  9 150 -1 3.49e+00 aaaa[cg]tttt
9 151 P  9 323 -1 3.49e+00 aaa[ct]tttta
9 234 P  9 234 -1 3.49e+00 gctg[cg]cagc