Ori-Finder 2 Result - jobID: 6I9FjBxJlu (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Pyrococcus abyssi GE5 chromosome, complete genome.
Chromosome size1765118 nt
Chromosome GC Level44.71%
The location of oriCs with ORB sequence122701..123499;
The location of DNA replication genes121402..122700;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 122701..123499
The size of oriC799 nt
The GC Level of oriC34.42%
DoriCORI10010003 ORI10010007 ORI10010101 ORI10010186 ORI10010016 ORI10010121
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common426445+-9.820372.33e-05CCCCCAGGGTTTCATTTCCA
Common431450+-10.26652.57e-05AGGGTTTCATTTCCACTGGA
Common709728--11.6053.4e-05AGAGTTTCATTTCCAGTGGA
Common714733--16.28978.64e-05CCCCCAGAGTTTCATTTCCA
The sequence of oriC
GACCTAAATTTCCAGTGGAAACATAACACTTTTCGCTAACATATTTTCATTGTGCATGACATAATGTGAC
ATTTAACACGACTATTTAAGCCAAACCGTAGAGAGTCTCCATTGGAAGCATTGGAACCAGAGGAAAGCAA
CGTAATAATCTATGGCCCACTTTTTATCCTTTGCCTTGACAAGAACATGTTAATGAAGATAATTTCATCT
GAAATTTATTCTCGAGAATTTCCACAGGAAACCTCCACAGGACATGAACAAGGATGTGCGTTGAATCTTT
ACATTTTCCAGTGGCCATAACCAATTTCCGATGGAAGGAAAATGAACATATATGTTCATTCAGATAAGAG
CATTTTTACACAAATAAGTGCATTAGGTTAACTTAATTTGTTTAATATTTTGCCAAAGTTAAACAGAAGT
GAAGTCCCCCAGGGTTTCATTTCCACTGGAACCGGGTTGCGACACCGAGAATATTCTATTCTTTTTTCTG
ACAAGACACTCTCCCATATTAGTTGGAACTCCTATTTAAATATTTATCTATGAACAGTTTTATAAGTAAA
TTGAGAAGCAGAGAAGCAAATGTTCACATATTTATGCACAAAATAGTACATCAACTGAAAAAATGTTCAT
TTGCAAAAGTAAAAATTTTTGGCTTTTAATTTTACGTTTGTAAACCAACGAAGAATTGCATGCCTTTCTC
AACCCAGTTCCACTGGAAATGAAACTCTGGGGGGTTCTTTAGATGGCTATCTGAATGCTAGCATATAAAT
CGAAAATATACAAGAAAATGTCAAAAAAA
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 799 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/6I9FjBxJlu/repfind.fasta
34 425 P 34 699 -3 9.83e-11
cccccag[ga]gtttcatttcca[cg]tggaac[ct]gggttg
29 433 P 29 696 -3 6.15e-08 gtttcatttcca[cg]tggaac[ct]gggttg[ca]ga
20 320 P 20 320  0 1.63e-07 aatgaacatatatgttcatt
21 233 R 21 233 -2 7.72e-05 acagga[ac]acctcca[ca]aggaca
21 642 R 21 653 -3 1.47e-03 aaat[tg]tttg[gc][ca]ttttaatttt
13   7 P 13 707  0 2.68e-03 atttccagtggaa
13 383 R 13 383  0 2.68e-03 taatttgtttaat
12   9 P 12 439  0 1.07e-02 ttccagtggaaa
12 217 P 12 217  0 1.07e-02 attctcgagaat
17 521 R 17 521 -2 1.28e-02 ctattta[at]a[ta]atttatc
14 437 F 14 704 -1 2.81e-02 ca[tg]ttccactggaa
11 440 F 11 707  0 4.28e-02 ttccactggaa
16   6 F 16 226 -2 4.51e-02 aatttcca[gc][ta]ggaaac
16 200 P 16 200 -2 4.51e-02 aatttca[tg][ca]tgaaatt
16 371 P 16 371 -2 4.51e-02 atta[ga]gttaac[tc]taat
16 446 P 16 696 -2 4.51e-02 tggaac[ct]gggttg[ca]ga
16 643 R 16 643 -2 4.51e-02 aatttt[tc]gg[ct]ttttaa
16 647 R 16 653 -2 4.51e-02 tttg[gc][ca]ttttaatttt
13   7 F 13 438 -1 1.04e-01 atttcca[gc]tggaa
13   8 P 13   8 -1 1.04e-01 tttcca[gc]tggaaa
13   8 P 13 228 -1 1.04e-01 tttcc[at]gtggaaa
13 227 F 13 438 -1 1.04e-01 atttccac[at]ggaa
13 319 R 13 775 -1 1.04e-01 aaa[ta]gaacatata
13 393 R 13 542 -1 1.04e-01 aatattttg[ca]caa
13 547 C 13 619 -1 1.04e-01 tttta[tc]aagtaaa
15 178 F 15 779 -2 1.58e-01 acaagaa[ca]atgt[tc]aa
15 211 R 15 515 -2 1.58e-01 aaatttat[tc]ctc[ga]ag
15 243 F 15 708 -2 1.58e-01 tccac[at]gga[ca]atgaa
15 398 F 15 629 -2 1.58e-01 tttgc[ca]aaagt[ta]aaa
15 584 R 15 584 -2 1.58e-01 cac[ag]tatttat[ga]cac
15 629 P 15 659 -2 1.58e-01 ttt[ga]caaa[ac]gtaaaa
10   8 F 10 284  0 1.71e-01 tttccagtgg
10 284 P 10 709  0 1.71e-01 tttccagtgg
10 319 P 10 622  0 1.71e-01 aaatgaacat
10 336 P 10 747  0 1.71e-01 cattcagata
10 467 P 10 467  0 1.71e-01 agaatattct
10 479 R 10 479  0 1.71e-01 tcttttttct
10 522 P 10 522  0 1.71e-01 tatttaaata
10 526 P 10 526  0 1.71e-01 taaatattta
10 640 P 10 640  0 1.71e-01 aaaaattttt
10 754 P 10 754  0 1.71e-01 atgctagcat
17   4 P 17   8 -3 1.92e-01 ta[at][ag]tttcca[gc]tggaaa
17 109 F 17 118 -3 1.92e-01 cattggaa[gc]ca[tg][ta]ggaa
17 519 P 17 526 -3 1.92e-01 tc[ca]ta[tg][ta]taaatattta
17 543 C 17 615 -3 1.92e-01 ac[at][gt]tttta[tc]aagtaaa
17 704 P 17 704 -3 1.92e-01 ca[gt]ttcca[cg]tggaa[ac]tg
12   9 F 12 707 -1 3.85e-01 ttcca[gc]tggaaa
12  37 P 12 615 -1 3.85e-01 aacat[at]ttttca
12 229 F 12 707 -1 3.85e-01 ttccac[at]ggaaa
12 328 C 12 775 -1 3.85e-01 tatatgttc[at]tt