Ori-Finder 2 Result - jobID: 7RIGONfLoP (motif: Common; motif count: 3; P-value: 1E-04)
Your Query:Aeropyrum pernix K1, complete genome.
Chromosome size1669696 nt
Chromosome GC Level56.31%
The location of oriCs with ORB sequence331264..331446; 444838..445534;
The location of DNA replication genes112111..113343; 331447..332634;
Z-curve figure
The left figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the original sequence. The right figure shows the Z-curves (AT, GC, RY and MK disparity curves) for the rotated sequence beginning and ending in the maximum of the GC disparity curve. Short vertical red line indicates the replication proteins location. The black arrows pointing below are the oriCs with ORB sequences, whereas the arrow pointing up is the oriCs without ORB sequences. Users could click to enlarge the image.
Note[ORB list of all intergenic regions]
OriC: 331264..331446
The size of oriC183 nt
The GC Level of oriC53.55%
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common137156--0.8971373.08e-06CACCATTGTTTTCCGCTGGA
The sequence of oriC
ATGGGGCCACCCTATCTTGCGCGCAACTCCAGTCTCGAATATTTGCGTGTAAAGACGGTATATATGTTTA
TAGAGTGGGGCAGCAGGATCGACGCAGAGGAGGCTAGGTAATACGGAGGCTCCCTTTCCTACAGGATCCA
GCGGAAAACAATGGTGTAGGGGTGGGTTGAGCTGGCGGATCCC
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 183 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/7RIGONfLoP/repfind.fasta
10  16 P 10  16  0 8.98e-03 ttgcgcgcaa
9  57 R  9  57  0 3.59e-02 gtatatatg
13  59 R 13  59 -2 9.85e-02 atat[at]tgt[ta]tata
9   6 P  9  69 -1 9.70e-01 ccac[ct]ctat
9  83 F  9 131 -1 9.70e-01 caggatc[gc]a
9 114 P  9 114 -1 9.70e-01 ggag[gc]ctcc
13   2 P 13 110 -3 1.08e+00 gg[ga]gcc[at]cc[cg]tat
13  38 R 13  59 -3 1.08e+00 atatttg[ct][ga]t[ga]ta
13  38 R 13  40 -3 1.08e+00 a[ta]at[tg]tgcgt[gt]ta
13  59 R 13  61 -3 1.08e+00 a[tg]atat[gt]t[tg]tata
13  85 R 13  95 -3 1.08e+00 ggatcg[ag][ca]g[cg]aga
11 164 R 11 164 -2 1.11e+00 ggt[tc]gag[ct]tgg
12   4 R 12 123 -3 3.33e+00 gg[ca]ca[ct]cct[at]tc
12  16 P 12  40 -3 3.33e+00 tt[ga]c[ga]cgcaa[ca]t
12  19 C 12 161 -3 3.33e+00 c[ga]c[gc]caactc[cg]a
12  33 P 12  35 -3 3.33e+00 c[tg]c[ga]aatatt[tc]g
12  58 F 12  60 -3 3.33e+00 tatat[ag]t[gt]t[ta]ta
12  89 C 12 118 -3 3.33e+00 cga[cg]g[cg]a[ga]agga
12  98 P 12 111 -3 3.33e+00 ggag[gc]ct[ac][gc]gta
12 117 R 12 122 -3 3.33e+00 g[ga]c[ta][ct]cctttcc
12 121 P 12 154 -3 3.33e+00 ccc[ta][tc][tc]cctaca
12 155 R 12 162 -3 3.33e+00 gt[ac]g[ga]g[gt]tgggt
8   6 C  8 160 -1 3.45e+00 ccaccc[ta]a
8  72 R  8 163 -1 3.45e+00 gagt[gt]ggg
8  72 R  8 158 -1 3.45e+00 g[ag]gtgggg
8  82 P  8 134 -1 3.45e+00 gc[at]ggatc
8  89 R  8  90 -1 3.45e+00 [ca]gacgcag
8  94 R  8  96 -1 3.45e+00 c[ag]gaggag
8  97 F  8 113 -1 3.45e+00 [ac]ggaggct
8 112 R  8 113 -1 3.45e+00 [at]cggaggc
8 131 P  8 133 -1 3.45e+00 c[at]ggatcc
8 158 R  8 159 -1 3.45e+00 [gt]gggtggg
10   5 P 10 110 -2 3.64e+00 gcc[at]cc[cg]tat
10  16 F 10  42 -2 3.64e+00 ttgcg[ct]g[ct]aa
10 114 F 10 173 -2 3.64e+00 gg[ac]gg[ca]tccc
10 120 R 10 120 -2 3.64e+00 tcc[ct]tt[tc]cct
10 126 P 10 126 -2 3.64e+00 tcct[ag][ct]agga
10 127 P 10 150 -2 3.64e+00 cctaca[gc][gc]at
11   2 F 11 114 -3 1.00e+01 gg[ga]g[cg]c[at]ccct
11   5 F 11 117 -3 1.00e+01 g[cg]c[at]ccct[at]tc
11   7 C 11  74 -3 1.00e+01 caccc[tc][ag]tc[tg]t
11  20 P 11  70 -3 1.00e+01 gc[gc]c[ac]actc[ct]a
11  27 P 11  27 -3 1.00e+01 tc[cg]ag[ta]ct[cg]ga
11  28 P 11  67 -3 1.00e+01 cca[gc]tct[ca][gt]aa
11  34 R 11  57 -3 1.00e+01 t[ct]g[at]atat[ta]tg
11  39 C 11  87 -3 1.00e+01 ta[tg][tc]tgcgt[gc]t
11  47 R 11  56 -3 1.00e+01 tgta[at]a[gt]a[ct]gg
11  61 R 11  63 -3 1.00e+01 a[tg]at[ga]ttt[ag]ta
11  69 F 11 150 -3 1.00e+01 at[ag]g[at]gt[ga]ggg
11  79 F 11 170 -3 1.00e+01 gc[at]g[cg][ac]ggatc
OriC: 444838..445534
The size of oriC697 nt
The GC Level of oriC59.54%
DoriCORI10010001
The information of ORB
Pattern nameStartEndStrandScoreP valueMatched Sequence
Common81100-29.44181.77e-10ACCCCTCCGTTTCCTGTGGA
Common154173+8.360712.75e-07ACCCCCCAGGTTCCTCTGGA
Common312331-17.28391.86e-08ACCCCCTGTTTTCCGCTGGA
Common361380-29.44181.77e-10ACCCCTCCGTTTCCTGTGGA
Common608627+-14.39355.96e-05ATCCCCGGGGTTCCTCTGCG
The sequence of oriC
AACCTACACCCGAAACACCAGTAGGATGGAGGCTCAAAATTAAGCTAGAAAGCGGGTCCAGATAGCTAGA
CTTAGGATGCTCCACAGGAAACGGAGGGGTCCTTATAAACCCCCGGCAACCACGCCACGCCGCACCCCGC
AGGAAAGCCCCACACCCCCCAGGTTCCTCTGGAGCATCAGAAGCGTATACTCCTCCCGAATAGTGCTCTT
GAAGAATGCCAATATAATGATACAAAAACCCAGTTTTAAACAAATCAAGCTAGAAACAAACAAAGACACA
CTATAATCCAGAACTGCACAGCCTGAGAGGATCCAGCGGAAAACAGGGGGTGTGGGGGCTTAGTGTGTCA
GCTCGCCGTCTCCACAGGAAACGGAGGGGTCGTATACCGGGGGGTTAACAACCTGCGGGAAGCGCATCCA
CCCCCACCCCCAACCATGAGGAGCCAGAACTAGCTGTCAACCATCACTATGCATACCCGGGAGGCGGCGC
CGGCCATAACCCGCCTTCTGTACTTCGGCGGCATTGGGCTAAGCGGTCTCCCCCCGGGCTTCGCGCGGCC
CTCACCGCCCGGGGGCCTTGCTCCGCCGGGGGCGGCCGTTTCACCGCATCCCCGGGGTTCCTCTGCGGTT
TGCTGCCGCCCTGTTGCCAGGGCGGCCTAGCCGCGTCCTCGACACGCCCCGGGGCCGTGTCGTTTCT
The information of repeats
The following lines contain repeats found, one line each.
[1] - repeat length of the first part
[2] - starting position of the first part
[3] - match direction
[4] - repeat length of the second part
[5] - starting position of the second part
[6] - distance of this repeat
[7] - calculated evalue of this repeat
[8] - repeat sequence

For more details, please refer to The Manual of REPuter.

# ./reputer/repfind -f -r -p -c -l 8 -best 50 -h 3 -s repfind.fasta

# 697 -3 8 /var/www/tubic/cgi-bin/Ori-Finder2/temp/7RIGONfLoP/repfind.fasta
22  79 F 22 359  0 7.77e-09 ctccacaggaaacggaggggtc
23 669 P 23 669 -3 9.28e-05 cgacacg[cg]ccc[gc]ggg[cg]cgtgtcg
15 261 R 15 261  0 1.27e-04 agaaacaaacaaaga
13 325 R 13 325  0 2.04e-03 gggggtgtggggg
13 419 R 13 419  0 2.04e-03 acccccaccccca
20  70 P 20 163 -3 3.82e-03 ctt[ac][gt]gatgctcca[cg]aggaa
15  36 F 15 251 -1 5.73e-03 aaat[tc]aagctagaaa
15  75 P 15 163 -1 5.73e-03 gatgctcca[cg]aggaa
12 124 R 12 124  0 8.14e-03 ccacgccgcacc
12 147 C 12 326  0 8.14e-03 ccccacaccccc
12 147 P 12 325  0 8.14e-03 ccccacaccccc
17 119 R 17 119 -2 9.73e-03 ccacgcc[ag]c[ga]ccgcacc
19 152 F 19 606 -3 1.30e-02 ca[ct]cccc[cg][ag]ggttcctctg
11 147 R 11 147  0 3.26e-02 ccccacacccc
11 417 R 11 417  0 3.26e-02 ccacccccacc
16 143 P 16 325 -2 3.44e-02 aa[ag][gc]ccccacaccccc
16 155 F 16 609 -2 3.44e-02 cccc[cg][ag]ggttcctctg
15 126 R 15 126 -2 1.20e-01 acgcc[gc]cac[cg]ccgca
15 480 C 15 580 -2 1.20e-01 gaggcggc[gc]cc[gc]gcc
15 565 F 15 674 -2 1.20e-01 cgccc[gc]ggggcc[tg]tg
15 582 R 15 582 -2 1.20e-01 ccg[cg]cgggggc[gc]gcc
10  41 F 10 256  0 1.30e-01 aagctagaaa
10 161 F 10 615  0 1.30e-01 ggttcctctg
10 675 P 10 675  0 1.30e-01 gccccggggc
12 417 F 12 423 -1 2.93e-01 ccaccccca[ca]cc
14 129 F 14 149 -2 4.17e-01 cc[ga]cacccc[gc]cagg
14 562 P 14 675 -2 4.17e-01 cac[cg]gccc[gc]ggggc
14 577 R 14 680 -2 4.17e-01 ttgct[cg][ct]gccgggg
14 584 R 14 584 -2 4.17e-01 gccgg[gc]gg[cg]ggccg
16 144 R 16 417 -3 4.81e-01 aa[gc]ccccac[ac]ccc[ca]cc
16 537 R 16 547 -3 4.81e-01 ctccc[cg][cg]cg[gc]gcttcg
9 246 R  9 246  0 5.21e-01 taaacaaat
9 274 P  9 340  0 5.21e-01 gacacacta
9 540 P  9 566  0 5.21e-01 cccccgggc
9 568 R  9 568  0 5.21e-01 ccgggggcc
9 634 P  9 647  0 5.21e-01 gccgccctg
11  30 C 11 238 -1 1.08e+00 gg[cg]tcaaaatt
11  46 P 11 498 -1 1.08e+00 agaa[ag]gcgggt
11  79 C 11  93 -1 1.08e+00 ctcc[ac]caggaa
11  93 C 11 359 -1 1.08e+00 gagg[gt]gtcctt
11 105 P 11 386 -1 1.08e+00 taa[ac]cccccgg
11 132 F 11 152 -1 1.08e+00 cacccc[gc]cagg
11 148 F 11 420 -1 1.08e+00 ccc[ac]caccccc
11 148 R 11 420 -1 1.08e+00 ccc[ac]caccccc
11 163 P 11 359 -1 1.08e+00 ttcct[cg]tggag
11 325 C 11 420 -1 1.08e+00 gggggtg[tg]ggg
11 325 P 11 420 -1 1.08e+00 gggggtg[tg]ggg
11 327 C 11 420 -1 1.08e+00 ggg[tg]gtggggg
11 327 P 11 420 -1 1.08e+00 ggg[tg]gtggggg
11 470 F 11 605 -1 1.08e+00 gcat[ac]cccggg