Take the genome of Streptococcus suis 98HAH33 as an example, which is described briefly as follows.
 
(i) The input file can be prepared in FASTA format as follows.

>gi|146319850|ref|NC_009443.1| Streptococcus suis 98HAH33, complete genome
ATGAACCAAGAACAACTTTTTTGGCAACGATTTATTGAATTGGCAAAGGTAAATTTTAAGCCATCTATTT
ATGATTTTTATGTCGCTGATGCAAAATTACTCGGAATCAACCAGCAAGTTGCCAATATTTTCTTAAATCG
......
......
......
CTTGTGGAAAATTTTTCTTAACAGTGTGGATTTTAAAAATTATCTGTGGAAAACTTTTGTTTTTTATGGT
ACACTATTCTAACGAATATAATGTGAAAGGGGGAAAAT
 

(ii) You can choose to paste the sequence into the input box or upload the sequence (FASTA format) in a file. Then, you will see BLAST Search Results against Indicator genes database 1.0 in the screen after clicking the 'Search' button.

 

(iii) According to the BLAST Search Results and the gene list gererated by ZCURVE1.02, you can replace the column "GeneName" of the genes in the gene list, which contain the sequences producing significant alignments, by "dnaA", "dnaN", "hemE", "gidA" etc, correspondingly. For example, the column "GeneName" of the gene (2066519..2068435), which contains a sequence (2066805..2067715) producing significant alignments based on BLASTN e-value equal to 1.0e-10 or lower with a gidA gene from Streptococcus sanguinis SK36 (125716887:c2362610-2360703 Streptococcus sanguinis SK36, gidA), is replaced by "gidA". Consequently, you will obtain the gene list with the annotation of gene function related to oriCs by this way.